CD32A (FCGR2A) (NM_021642) Human Untagged Clone

CAT#: SC112914

FCGR2A (untagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FCGR2A
• Synonyms: CD32; CD32A; CDw32; FCG2; FcGR; FCGR2; FCGR2A1; IGFR2
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_021642, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTATGGAGACCCAAATGTCTCAGAATGTATGTCCCAGAAACCTGTGGCTGCTTCAACCATTGACAG
  TTTTGCTGCTGCTGGCTTCTGCAGACAGTCAAGCTGCTCCCCCAAAGGCTGTGCTGAAACTTGAGCCCCC
  GTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTGACATGCCAGGGGGCTCGCAGCCCTGAGAGCGAC
  TCCATTCAGTGGTTCCACAATGGGAATCTCATTCCCACCCACACGCAGCCCAGCTACAGGTTCAAGGCCA
  ACAACAATGACAGCGGGGAGTACACGTGCCAGACTGGCCAGACCAGCCTCAGCGACCCTGTGCATCTGAC
  TGTGCTTTCCGAATGGCTGGTGCTCCAGACCCCTCACCTGGAGTTCCAGGAGGGAGAAACCATCATGCTG
  AGGTGCCACAGCTGGAAGGACAAGCCTCTGGTCAAGGTCACATTCTTCCAGAATGGAAAATCCCAGAAAT
  TCTCCCATTTGGATCCCACCTTCTCCATCCCACAAGCAAACCACAGTCACAGTGGTGATTACCACTGCAC
  AGGAAACATAGGCTACACGCTGTTCTCATCCAAGCCTGTGACCATCACTGTCCAAGTGCCCAGCATGGGC
  AGCTCTTCACCAATGGGGATCATTGTGGCTGTGGTCATTGCGACTGCTGTAGCAGCCATTGTTGCTGCTG
  TAGTGGCCTTGATCTACTGCAGGAAAAAGCGGATTTCAGCCAATTCCACTGATCCTGTGAAGGCTGCCCA
  ATTTGAGCCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGACTAT
  GAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGATAAAAACATCTACC
  TGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAA
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_021642
• Insert Size: 2250 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021642.3, NP_067674.2
• RefSeq Size: 2426 bp
• RefSeq ORF: 951 bp
• Locus ID: 2212
• Cytogenetics: 1q23.3
• Domains: ig, IGc2, IG
• Protein Families: ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Fc gamma R-mediated phagocytosis, Systemic lupus erythematosus
• Gene Summary: 'This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.