Apolipoprotein CIII (APOC3) (NM_000040) Human Untagged Clone

CAT#: SC113775

APOC3 (untagged)-Human apolipoprotein C-III (APOC3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APOC3
• Synonyms: APOCIII
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC113775 sequence for NM_000040 edited (data generated by NextGen Sequencing)
  ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCT
  TCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGGGCTACATGAAGCACGCCACC
  AAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGG
  GGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAG
  TTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGA
  
  Clone variation with respect to NM_000040.1
  102 t=>c
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_000040 unedited
  GCACGAGGTTCATCCCTAGAGGCAGCTGCTCCAGGAACAGAGGTGCCATGCAGCCCCGGG
  TACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGG
  ATGCCTCCCTTCTCAGCTTCATGCAGGGCTACATGAAGCACGCCACCAAGACCGCCAAGG
  ATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCG
  ATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAGTTCTCTGAGTTCT
  GGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCC
  CAAGTCCACCTGCCTATCCATCCTGCCAGCTCCTTGGGTCCTGCAATCTCCAGGGCTTCC
  CCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTG
  GCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCTGCTAN
  
• Restriction Sites: NotI-NotI
• ACCN: NM_000040
• Insert Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000040.1, NP_000031.1
• RefSeq Size: 533 bp
• RefSeq ORF: 300 bp
• Locus ID: 345
• Cytogenetics: 11q23.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: PPAR signaling pathway
• Gene Summary: 'This gene encodes a protein component of triglyceride (TG)-rich lipoproteins (TRLs) including very low density lipoproteins (VLDL), high density lipoproteins (HDL) and chylomicrons. The encoded protein plays a role in role in the metabolism of these TRLs through multiple modes. This protein has been shown to promote the secretion of VLDL1, inhibit lipoprotein lipase enzyme activity, and delay catabolism of TRL remnants. Mutations in this gene are associated with low plasma triglyceride levels and reduced risk of ischemic cardiovascular disease, and hyperalphalipoproteinemia, which is characterized by elevated levels of high density lipoprotein (HDL) and HDL cholesterol in human patients. This gene and other related genes comprise an apolipoprotein gene cluster on chromosome 11. [provided by RefSeq, Sep 2017]'