VAMP2 (NM_014232) Human Untagged Clone

CAT#: SC115104

VAMP2 (untagged)-Human vesicle-associated membrane protein 2 (synaptobrevin 2) (VAMP2)


  "NM_014232" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "VAMP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VAMP2
Synonyms SYB2; VAMP-2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115104 sequence for NM_014232 edited (data generated by NextGen Sequencing)
ATGTCTGCTACCGCTGCCACGGCCCCCCCTGCTGCCCCGGCTGGGGAGGGTGGTCCCCCT
GCACCCCCTCCAAACCTCACCAGTAACAGGAGACTGCAGCAGACCCAGGCCCAGGTGGAT
GAGGTGGTGGACATCATGAGGGTGAACGTGGACAAGGTCCTGGAGCGAGACCAGAAGCTG
TCGGAGCTGGACGACCGTGCAGATGCACTCCAGGCGGGGGCCTCCCAGTTTGAAACAAGC
GCAGCCAAGCTCAAGCGCAAATACTGGTGGAAAAACCTCAAGATGATGATCATCTTGGGA
GTGATTTGCGCCATCATCCTCATCATCATCATAGTTTACTTCAGCACTTAA

Clone variation with respect to NM_014232.2
>OriGene 5' read for NM_014232 unedited
TCTTGGCATATTTGNAATCACGACTTCACTATAGGNCGGCACGCGCAATTCGGCACGAGG
CCAGTCGGAGCCGCGCGAGCCGCCGCCGCCATCACTGCCGCTGCCAAGTCCTCCACCCGC
TGCCCCCGCCATGTCTGCTACCGCTGCCACGGCCCCCCCTGCTGCCCCGGCTGGGGAGGG
TGGTCCCCCTGCACCCCCTCCAAACCTCACCAGTAACAGGATACTGCAGCAGACCCAGGC
CCATGTGGATGAGGTGGTGGACATCATGAGGGTGAACGTGGACAAGGTCCTGGAGCGAGA
CCAGAAGCTGTCGGAGCTGGACGACCGTGCAGATGCACTCCAGGCGGGGGCCTCCCAGTT
TGAAACAAGCGCAGCCAAGCTCAAGCGCAAATACTGGTGGAAAAACCTCAAGATGATGAT
CATCTTGGGAGTGATTTGCGCCATCATCCTCATCATCATCATAGTTTACTTCAGCACTTA
AATCCCCGAGGAGTCTGCCCTGCCTAGAGAAGGGCCTCTCCCCCAACCCTCAGCCGTTCC
TCCACCTCTCAGCCATATCTTTCAGCCCCCCCTCCCCTGGATCCGTGTGTGTGTGTGTCC
GTGTGTGTGTCCCCCTGTAAATAGCCAGCTGTTATTTATACATATATAATATTATATATA
TTTGGTCTGTTTGTAGTTTTATTACTAGATGATTTTTCCGGTTGTCCTTAACACCCCTTC
CTGAGGTTCCCTTCACCCCTCTCTCTTGCCTTACTTCCCTTTCCCTTTCTTCCTGACTAG
CCCCAAAGTCCCTTCATTTGCATCTGCTATGCAATAGTCCCTCTCCTTTCCTTCTNCTNC
CCTCAGATTTAGCTGATCCTTCCTNCCACCCTGGNCCTTCCTTTNCTCTTTNCTNCTNAC
TCTNCCCGTCATGCTCCCTCTGCCCCGGCCTNNAAAANANNANNAANNNNANNNNNNNNN
NANAAAA
Restriction Sites NotI-NotI     
ACCN NM_014232
Insert Size 1190 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014232.1, NP_055047.1
RefSeq Size 2159 bp
RefSeq ORF 351 bp
Locus ID 6844
Cytogenetics 17p13.1
Domains synaptobrevin
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary 'The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1) encodes isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.