DNAJB2 (NM_001039550) Human Untagged Clone

CAT#: SC115897

DNAJB2 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 1


  "NM_001039550" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "DNAJB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJB2
Synonyms CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115897 sequence for NM_001039550 edited (data generated by NextGen Sequencing)
ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAG
AAGGCGTATCGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAG
TTTGCTGAGAAGAAATTTAAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACAAGCAC
AAGCGGGAGATTTACGACCGCTATGGCCGGGAAGGGCTGACAGGGACAGGAACTGGCCCA
TCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCTTCACCTTCCGCAGCCCCGAG
GAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCTTTGATGACCTG
GGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCTTTACCTTC
TCTTCCTCCTTCCCTGGGCACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGG
GCTGGTGCTTTTCGCTCTGTTTCTACATCTACCACCTTTGTCCAAGGACGCCGCATCACC
ACACGCAGAATCATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTG
AAGTCAGTCACAATCAATGGTGTCCCAGATGACCTGGCACTGGGCTTGGAGCTGAGCCGT
CGCGAGCAGCAGCCGTCAGTCACTTCCAGGTCTGGGGGCACTCAGGTCCAGCAGACCCCT
GCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAGGACCTGCAGCTGGCCATGGCC
TACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGATGTGTTCTGA

Clone variation with respect to NM_001039550.1
Restriction Sites Please inquire     
ACCN NM_001039550
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039550.1, NP_001034639.1
RefSeq Size 1978 bp
RefSeq ORF 834 bp
Locus ID 3300
Cytogenetics 2q35
Gene Summary 'This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]'
Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.