BCA1 (CXCL13) (NM_006419) Human Untagged Clone

CAT#: SC116106

CXCL13 (untagged)-Human chemokine (C-X-C motif) ligand 13 (CXCL13)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CXCL13
• Synonyms: ANGIE; ANGIE2; BCA-1; BCA1; BLC; BLR1L; SCYB13
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006419, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGTTCATCTCGACATCTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTTC
  TGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGCTT
  CATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAGAAG
  AACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGAAAAA
  GAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006419
• ORF Size: 330 bp
• Insert Size: 1600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_006419.2, NP_006410.1
• RefSeq Size: 1219
• RefSeq ORF: 330
• Locus ID: 10563
• Domains: IL8
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014]