S100A1 (NM_006271) Human Untagged Clone

CAT#: SC116181

S100A1 (untagged)-Human S100 calcium binding protein A1 (S100A1)


  "NM_006271" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "S100A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol S100A1
Synonyms S100; S100-alpha; S100A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_006271 edited
ATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTTCCACGCCCACTCG
GGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGAGCTGCTGCAGACG
GAGCTCTCTGGCTTCCTGGATGCCCAGAAGGATGTGGATGCTGTGGACAAGGTGATGAAG
GAGCTAGACGAGAATGGAGACGGGGAGGTGGACTTCCAGGAGTATGTGGTGCTTGTGGCT
GCTCTCACAGTGGCCTGTAACAATTTCTTCTGGGAGAACAGTTGA
>OriGene 5' read for NM_006271 unedited
GCACGAGGGCCATCTGTCCAGAACCTGCTCCCACCTCAGGCCCAGGCCAACCGTGCACTG
CTGCAATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTTCCACGCCC
ACTCGGGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGAGCTGCTGC
AGACGGAGCTCTCTGGCTTCCTGGATGCCCAGAAGGATGTGGATGCTGTGGACAAGGTGA
TGAAGGAGCTAGACGAGAATGGAGACGGGGNAGGTGGACTTCCAGGAGTATGTGGTGCTT
GTGGCTGCTCTCACAGTGGCCTGTAACAATTTCTTCTGGGAGAACAGTTGAGCAGACAGC
CACATTGGGCAGCGCCCTTCCTCTCCACCCTCCCAGACCTGCCTCTTCCCCCTGCTTCCA
CCTCACCCCACTTATCCCTTNNCTAAAACCNCAACCCCTGCCCACCCCACCCCCACCCCC
ACCAAGGGCGCAAGAGTAGCGGTCCAAGCCTGCAACTCATCTTTCATTAAAGGCTTCTCT
CTCACCAAAAAAAAAAAAAAAAAACTCGACTCT
Restriction Sites NotI-NotI     
ACCN NM_006271
Insert Size 530 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006271.1, NP_006262.1
RefSeq Size 607 bp
RefSeq ORF 285 bp
Locus ID 6271
Cytogenetics 1q21.3
Gene Summary 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.