S100A1 (NM_006271) Human Untagged Clone

CAT#: SC116181

S100A1 (untagged)-Human S100 calcium binding protein A1 (S100A1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: S100A1
• Synonyms: S100; S100-alpha; S100A
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_006271 edited
  ATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTTCCACGCCCACTCG
  GGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGAGCTGCTGCAGACG
  GAGCTCTCTGGCTTCCTGGATGCCCAGAAGGATGTGGATGCTGTGGACAAGGTGATGAAG
  GAGCTAGACGAGAATGGAGACGGGGAGGTGGACTTCCAGGAGTATGTGGTGCTTGTGGCT
  GCTCTCACAGTGGCCTGTAACAATTTCTTCTGGGAGAACAGTTGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_006271 unedited
  GCACGAGGGCCATCTGTCCAGAACCTGCTCCCACCTCAGGCCCAGGCCAACCGTGCACTG
  CTGCAATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTTCCACGCCC
  ACTCGGGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGAGCTGCTGC
  AGACGGAGCTCTCTGGCTTCCTGGATGCCCAGAAGGATGTGGATGCTGTGGACAAGGTGA
  TGAAGGAGCTAGACGAGAATGGAGACGGGGNAGGTGGACTTCCAGGAGTATGTGGTGCTT
  GTGGCTGCTCTCACAGTGGCCTGTAACAATTTCTTCTGGGAGAACAGTTGAGCAGACAGC
  CACATTGGGCAGCGCCCTTCCTCTCCACCCTCCCAGACCTGCCTCTTCCCCCTGCTTCCA
  CCTCACCCCACTTATCCCTTNNCTAAAACCNCAACCCCTGCCCACCCCACCCCCACCCCC
  ACCAAGGGCGCAAGAGTAGCGGTCCAAGCCTGCAACTCATCTTTCATTAAAGGCTTCTCT
  CTCACCAAAAAAAAAAAAAAAAAACTCGACTCT
  
• Restriction Sites: NotI-NotI
• ACCN: NM_006271
• Insert Size: 530 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006271.1, NP_006262.1
• RefSeq Size: 607 bp
• RefSeq ORF: 285 bp
• Locus ID: 6271
• Cytogenetics: 1q21.3
• Gene Summary: 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]'