HES1 (NM_005524) Human Untagged Clone
CAT#: SC116707
HES1 (untagged)-Human hairy and enhancer of split 1, (Drosophila) (HES1)
"NM_005524" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HES1 |
Synonyms | bHLHb39; HES-1; HHL; HRY |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC116707 sequence for NM_005524 edited (data generated by NextGen Sequencing)
ATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGT GTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCT ATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTG ATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATT CTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTG AGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAG GTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTC GGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCAC CCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCG TTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGC GCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAG GTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCAC AGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCA GTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAAC TGA Clone variation with respect to NM_005524.3 |
Restriction Sites | Please inquire |
ACCN | NM_005524 |
Insert Size | 1600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005524.2, NP_005515.1 |
RefSeq Size | 1471 bp |
RefSeq ORF | 843 bp |
Locus ID | 3280 |
Cytogenetics | 3q29 |
Domains | HLH, ORANGE |
Protein Families | Adult stem cells, Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Stem cell relevant signaling - DSL/Notch pathway, Transcription Factors |
Protein Pathways | Maturity onset diabetes of the young, Notch signaling pathway |
Gene Summary | 'This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211709 | HES1 (Myc-DDK-tagged)-Human hairy and enhancer of split 1, (Drosophila) (HES1) |
USD 420.00 |
|
RG211709 | HES1 (GFP-tagged) - Human hairy and enhancer of split 1, (Drosophila) (HES1) |
USD 460.00 |
|
RC211709L1 | Lenti ORF clone of Human hairy and enhancer of split 1, (Drosophila) (HES1), Myc-DDK-tagged |
USD 768.00 |
|
RC211709L2 | Lenti ORF clone of Human hairy and enhancer of split 1, (Drosophila) (HES1), mGFP tagged |
USD 768.00 |
|
RC211709L3 | Lenti ORF clone of Human hairy and enhancer of split 1, (Drosophila) (HES1), Myc-DDK-tagged |
USD 768.00 |
|
RC211709L4 | Lenti ORF clone of Human hairy and enhancer of split 1, (Drosophila) (HES1), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review