Cystatin A (CSTA) (NM_005213) Human Untagged Clone

CAT#: SC116847

CSTA (untagged)-Human cystatin A (stefin A) (CSTA)


  "NM_005213" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CSTA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSTA
Synonyms AREI; PSS4; STF1; STFA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005213 edited
ATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAATCCAGGAGATTGTT
GATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGGAAAATTGGAAGCT
GTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAAGGTACGAGCAGGT
GATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACAAAATGAGGACTTG
GTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGACGGGCTTTTAG
>OriGene 5' read for NM_005213 unedited
GCACGTCAAATTTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGCAAAGAA
GCAATCAGCCAAAATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAAT
CCAGGAGATTGTTGATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGG
AAAATTGGAAGCTGTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAA
GGTACGAGCAGGTGATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACA
AAATGAGGACTTGGTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGAC
GGGCTTTTAGCAGCATGTACCCAAAGTGTTCTGATTCCTTCAACTGGCTACTGAGTCATG
ATCCTTGCTGATAAATATAACCATCAATAAAGAAGCATTCTTTTCCAAAGAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAACTAAACTCTAAAATTGCGGCCGCGGACATAAAATGTT
ACCTGAACANATCCCGGGTGTCCTCCTTGTGACCCGGCCCCAGTGTTTATCTTGTCCCTG
AAAATTCCGGTGGGGTTCCCAGGAGCCTTTTCCCAGGACCTTTAAGTGGCCTGAAATTGG
CAAACTAGGTGCCCCCCAATATTTTTATAAAAAAATATGGGGGCGGTATATTGCCCCGCC
AAAGTCCTTTATAAAAATGTGGGGCCTGAAGGGGGCTATTTTTACCAAGGGTGCAATTTG
GGAACACATCCTTGGGTGCCTGGGGGGTCATTTTGGAAACCAAATGGGAATTTTGGGCCC
AAATCTTGCCCACTGAAGGGACCCACGCGGGGTTAAGCAAACTTCTTGATTAAAGTT
Restriction Sites NotI-NotI     
ACCN NM_005213
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005213.3, NP_005204.1
RefSeq Size 838 bp
RefSeq ORF 297 bp
Locus ID 1475
Cytogenetics 3q21.1
Domains CY
Gene Summary 'The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.