TBCA (NM_004607) Human Untagged Clone

CAT#: SC117262

TBCA (untagged)-Human tubulin folding cofactor A (TBCA)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TBCA
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_004607 edited
  ATGGCCGATCCTCGCGTGAGACAGATCAAGATCAAGACCGGCGTGGTGAAGCGGTTGGTC
  AAAGAAAAAGTGATGTATGAAAAAGAGGCAAAACAACAAGAAGAAAAGATTGAAAAAATG
  AGAGCTGAAGACGGTGAAAATTATGACATTAAAAAGCAGGCAGAGATCCTACAAGAATCC
  AGGATGATGATCCCAGATTGCCAGCGCAGGTTGGAAGCCGCATATTTGGATCTTCAACGG
  ATACTAGAAAATGAAAAAGACTTGGAAGAAGCTGAGGAATATAAAGAAGCACGTTTAGTA
  CTGGATTCAGTGAAGTTAGAAGCCTGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_004607 unedited
  CGGCCGCGAATTCGGCACGAGCCGGCGACCACGCCTAAATAGCCGCAGCCTCTGCGCGTC
  GCCCTCCACGGTTACCCCGGCTCTCCGCCCCTCCTTCTCGCGGCGCTCGAGGGACCATGG
  CCGATCCTCGCGTGAGACAGATCAAGATCAAGACCGGCGTGGTGAAGCGGTTGGTCAAAG
  AAAAAGTGATGTATGAAAAAGAGGCAAAACAACAAGAAGAAAAGATTGAAAAAATGAGAG
  CTGAAGACGGTGAAAATTATGACATTAAAAAGCAGGCAGAGATCCTACAAGAATCCAGGA
  TGATGATCCCAGATTGCCAGCGCAGGTTGGAAGCCGCATATTTGGATCTTCAACGGATAC
  TAGAAAATGAAAAAGACTTGGAAGAAGCTGAGGAATATAAAGAAGCACGTTTAGTACTGG
  ATTCAGTGAAGTTAGAAGCCTGAAACTTTTCTCGTATGGGGGTGGTTTTTGCATTAAATC
  CTGGGGTCCATTTTACAATCCATTATTTTTGACCACTGCTATGTGTTCAAGTAGTATGAG
  AATGTGATTGTTTTTATCTGGTTCATATATATTTCTTTGTCTAATTTAATATGTCAAATA
  AATGGAGTTCATCTAAAAAAAAAAAAAAAAAACTCTAGATTGCGGCCGCGGTCATAGCTG
  TTTCCTGACAGATCCCGGGTGGCATCCTGTGACCCCTCCCAGTGCCTCTCCTGGCCTGGA
  A
  
• Restriction Sites: NotI-NotI
• ACCN: NM_004607
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004607.1, NP_004598.1
• RefSeq Size: 574 bp
• RefSeq ORF: 327 bp
• Locus ID: 6902
• Cytogenetics: 5q14.1
• Domains: TBCA
• Gene Summary: 'The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (2) has a split 3' terminal exon, which results in an alternate translation stop codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.