NDUFA3 (NM_004542) Human Untagged Clone

CAT#: SC117329

NDUFA3 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa (NDUFA3)


  "NM_004542" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NDUFA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFA3
Synonyms B9; CI-B9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_004542 edited
ATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAATGCCTGGGACAAGGAGCCAGTGCTGGTC
GTGTCCTTCGTCGTCGGGGGCCTCGCTGTAATTCTGCCCCCATTGAGCCCCTACTTCAAG
TACTCCGTCATGATCAACAAGGCCACGCCCTACAACTACCCAGTGCCCGTCCGTGATGAT
GGGAACATGCCCGACGTGCCCAGCCACCCCCAGGACCCTCAGGGCCCCAGCCTGGAGTGG
CTGAAGAAACTGTGA
>OriGene 5' read for NM_004542 unedited
CGGCCGCGAATTCGGCACGAGGCGGANACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTC
AAGAATGCCTGGGACAAGGAGCCAGTGCTGGTCGTGTCCTTCGTCGTCGGGGGCCTCGCT
GTAATTCTGCCCCCATTGAGCCCCTACTTCAAGTACTCCGTCATGATCAACAAGGCCACG
CCCTACAACTACCCAGTGCCCGTCCGTGATGATGGGAACATGCCCGACGTGCCCAGCCAC
CCCCAGGACCCTCAGGGCCCCAGCCTGGAGTGGCTGAAGAAACTGTGAGCACCTCCACTG
ACAGAGGCGGCCCCTCCCACGGCTCCCAATAAAAATGTGAAAACCAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
ACCN NM_004542
Insert Size 4670 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004542.1, NP_004533.1
RefSeq Size 360 bp
RefSeq ORF 255 bp
Locus ID 4696
Cytogenetics 19q13.42
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary ''

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.