Cytochrome C Oxidase subunit VIc (COX6C) (NM_004374) Human Untagged Clone

CAT#: SC117420

COX6C (untagged)-Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COX6C
• Synonyms: cytochrome c oxidase subunit VIc; cytochrome c oxidase subunit VIc preprotein
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004374, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGG
  CTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAA
  GGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAAGGCTGGTATC
  TTTCAGAGTGTAAAGTAA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_004374 unedited
  GCACGAGGGGACGTTGGTGTTGAGGTTAGCATACGNTATCAGGACAGTAACTACCATGGC
  TCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCA
  TATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGC
  TGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTT
  TGAGGAGATGAGGAAGGCTGGTATCTTTCAGAGTGTAAAGTAATCTTGGAATATAAAGAA
  TTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGACTTGTGTTCCTGAACTATGACAC
  ATGAATATGTGGGCTAAGAAATAGTTCCTCTTGATAAATAAACAATTAACANATANNAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
  
• Restriction Sites: NotI-NotI
• ACCN: NM_004374
• Insert Size: 4540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004374.2, NP_004365.1
• RefSeq Size: 444 bp
• RefSeq ORF: 228 bp
• Locus ID: 1345
• Cytogenetics: 8q22.2
• Domains: COX6C
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]'