alpha Defensin 1 (DEFA1) (NM_004084) Human Untagged Clone

CAT#: SC117582

DEFA1 (untagged)-Human defensin, alpha 1 (DEFA1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFA1
• Synonyms: DEF1; DEFA2; HNP-1; HP-1; HP1; MRS
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC117582 sequence for NM_004084 edited (data generated by NextGen Sequencing)
  ATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTGCAGGCCCAGGCTGAG
  CCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAGATTGCAGCGGACATC
  CCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAGCTTGGCTCCAAAGCATCCAGGCTCA
  AGGAAAAACATGGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTAT
  GGAACCTGCATCTACCAGGGAAGACTCTGGGCATTCTGCTGCTGA
  
  Clone variation with respect to NM_004084.3
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_004084 unedited
  TATAGGCGGCCGCGACATCGGCACCAGTGCCCTCTCTGGTCACCCTGCCTAGCTAGAGGA
  TCTGTGACCCCAGCCATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTG
  CAGGCCCAGGCTGAGCCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAG
  CTTGCAGCGGACATCCCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAAGCTTGGCTCC
  AAAGCATCCAGGCTCAAGGAAAACATGGACTGCTATTGCAGAATACCAGCGTGCATTGCA
  GGAGAACGTCGCTATGGAACCTGCATCTACCAAGGGAAGACTCTGGGCATTCTGCTGCTG
  AGCTTGCAGAAAAAGAAAAATGAAGCTCAAAATTTGCTTTGAGAGCTACAGGGAATTGCT
  ATTACTCCTGTACCTTCTGCTCAATTTCCTTTCCTTATCTCAAATAAATGCCTTGTTACA
  AAAAN
  
• Restriction Sites: NotI-NotI
• ACCN: NM_004084
• Insert Size: 680 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004084.2, NP_004075.1
• RefSeq Size: 490 bp
• RefSeq ORF: 285 bp
• Locus ID: 1667
• Cytogenetics: 8p23.1
• Domains: Defensin_propep, DEFSN, defensins
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. [provided by RefSeq, Oct 2014]'