TNFRSF4 (NM_003327) Human Untagged Clone
CAT#: SC118037
TNFRSF4 (untagged)-Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4)
"NM_003327" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TNFRSF4 |
| Synonyms | ACT35; CD134; IMD16; OX40; TXGP1L |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_003327 edited
CCGCAAGGAAAACCCAGACTCTGGCGACAGCAGAGACGAGGATGTGCGTGGGGGCTCGGC GGCTGGGCCGCGGGCCGTGTGCGGCTCTGCTCCTCCTGGGCCTGGGGCTGAGCACCGTGA CGGGGCTCCACTGTGTCGGGGACACCTACCCCAGCAACGACCGGTGCTGCCACGAGTGCA GGCCAGGCAACGGGATGGTGAGCCGCTGCAGCCGCTCCCAGAACACGGTGTGCCGTCCGT GCGGGCCGGGCTTCTACAACGACGTGGTCAGCTCCAAGCCGTGCAAGCCCTGCACGTGGT GTAACCTCAGAAGTGGGAGTGAGCGGAAGCAGCTGTGCACGGCCACACAGGACACAGTCT GCCGCTGCCGGGCGGGCACCCAGCCCCTGGACAGCTACAAGCCTGGAGTTGACTGTGCCC CCTGCCCTCCAGGGCACTTCTCCCCAGGCGACAACCAGGCCTGCAAGCCCTGGACCAACT GCACCTTGGCTGGGAAGCACACCCTGCAGCCGGCCAGCAATAGCTCGGACGCAATCTGTG AGGACAGGGACCCCCCAGCCACGCAGCCCCAGGAGACCCAGGGCCCCCCGGCCAGGCCCA TCACTGTCCAGCCCACTGAAGCCTGGCCCAGAACCTCACAGGGACCCTCCACCCGGCCCG TGGAGGTCCCCGGGGGCCGTGCGGTTGCCGCCATCCTGGGCCTGGGCCTGGTGCTGGGGC TGCTGGGCCCCCTGGCCATCCTGCTGGCCCTGTACCTGCTCCGGAGGGACCAGAGGCTGC CCCCCGATGCCCACAAGCCCCCTGGGGGAGGCAGTTTCCGGACCCCCATCCAAGAGGAGC AGGCCGACGCCCACTCCACCCTGGCCAAGATCTGACCTGGGCCCACCAAGGTGGACGCTG GGCCCCGCCAGGCTGGAGCCCGGAGGGTCTGCTGGGCGAGCAGGGCAGGTGCAGGCCGCC TGCCCCGCCACGCTCCTGGGCCAACTCTGCACCGTTCTAGGTGCCGATGGCTGCCTCCGG CTCTCTGCTTACGTATGCCATGCATACCTCCTGCCCCGCGGGACCACAATAAAAACCTTG GCAGACGGGA |
| Restriction Sites | Please inquire |
| ACCN | NM_003327 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003327.2. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003327.2, NP_003318.1 |
| RefSeq Size | 1084 bp |
| RefSeq ORF | 834 bp |
| Locus ID | 7293 |
| Cytogenetics | 1p36.33 |
| Domains | TNFR |
| Protein Families | Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | 'The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been shown to activate NF-kappaB through its interaction with adaptor proteins TRAF2 and TRAF5. Knockout studies in mice suggested that this receptor promotes the expression of apoptosis inhibitors BCL2 and BCL2lL1/BCL2-XL, and thus suppresses apoptosis. The knockout studies also suggested the roles of this receptor in CD4+ T cell response, as well as in T cell-dependent B cell proliferation and differentiation. [provided by RefSeq, Jul 2008]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211253 | TNFRSF4 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4) |
USD 450.00 |
|
| RG211253 | TNFRSF4 (GFP-tagged) - Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4) |
USD 460.00 |
|
| RC211253L1 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), Myc-DDK-tagged |
USD 768.00 |
|
| RC211253L2 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mGFP tagged |
USD 768.00 |
|
| RC211253L3 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), Myc-DDK-tagged |
USD 768.00 |
|
| RC211253L4 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China