SC35 (SRSF2) (NM_003016) Human Untagged Clone

CAT#: SC118248

SRSF2 (untagged)-Human serine/arginine-rich splicing factor 2 (SRSF2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRSF2
• Synonyms: PR264; SC-35; SC35; SFRS2; SFRS2A; SRp30b
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003016, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTACGGCCGCCCCCCTCCCGATGTGGAGGGTATGACCTCCCTCAAGGTGGACAACCTGACCTACC
  GCACCTCGCCCGACACGCTGAGGCGCGTCTTCGAGAAGTACGGGCGCGTCGGCGACGTGTACATCCCGCG
  GGACCGCTACACCAAGGAGTCCCGCGGCTTCGCCTTCGTTCGCTTTCACGACAAGCGCGACGCTGAGGAC
  GCTATGGATGCCATGGACGGGGCCGTGCTGGACGGCCGCGAGCTGCGGGTGCAAATGGCGCGCTACGGCC
  GCCCCCCGGACTCACACCACAGCCGCCGGGGACCGCCACCCCGCAGGTACGGGGGCGGTGGCTACGGACG
  CCGGAGCCGCAGCCCTAGGCGGCGTCGCCGCAGCCGATCCCGGAGTCGGAGCCGTTCCAGGTCTCGCAGC
  CGATCTCGCTACAGCCGCTCGAAGTCTCGGTCCCGCACTCGTTCTCGATCTCGGTCGACCTCCAAGTCCA
  GATCCGCACGAAGGTCCAAGTCCAAGTCCTCGTCGGTCTCCAGATCTCGTTCGCGGTCCAGGTCCCGGTC
  TCGGTCCAGGAGTCCTCCCCCAGTGTCCAAGAGGGAATCCAAATCCAGGTCGCGATCGAAGAGTCCCCCC
  AAGTCTCCTGAAGAGGAAGGAGCGGTGTCCTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_003016
• Insert Size: 3000 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_003016.4, NP_003007.2
• RefSeq Size: 3003 bp
• RefSeq ORF: 666 bp
• Locus ID: 6427
• Cytogenetics: 17q25.1
• Domains: RRM
• Protein Families: Stem cell - Pluripotency, Transcription Factors
• Protein Pathways: Spliceosome
• Gene Summary: 'The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]'
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 both encode the same protein.