GRO beta (CXCL2) (NM_002089) Human Untagged Clone

CAT#: SC118823

CXCL2 (untagged)-Human chemokine (C-X-C motif) ligand 2 (CXCL2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CXCL2
• Synonyms: CINC-2a; GRO2; GROb; MGSA-b; MIP-2a; MIP2; MIP2A; SCYB2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002089, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCGCGCCACGCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGGGTGGCGCTGCTGCTCCTGC
  TCCTGGTGGCCGCCAGCCGGCGCGCAGCAGGAGCGCCCCTGGCCACTGAACTGCGCTGCCAGTGCTTGCA
  GACCCTGCAGGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCC
  CAAACCGAAGTCATAGCCACACTCAAGAATGGGCAGAAAGCTTGTCTCAACCCCGCATCGCCCATGGTTA
  AGAAAATCATCGAAAAGATGCTGAAAAATGGCAAATCCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002089
• Insert Size: 1060 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002089.3, NP_002080.1
• RefSeq Size: 1234 bp
• RefSeq ORF: 324 bp
• Locus ID: 2920
• Cytogenetics: 4q13.3
• Domains: IL8
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway
• Gene Summary: 'This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]'