GABPB2 (GABPB1) (NM_002041) Human Untagged Clone
CAT#: SC118866
GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1
"NM_002041" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GABPB1 |
Synonyms | BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002041, the custom clone sequence may differ by one or more nucleotides
ATGTCCCTGGTAGATTTGGGAAAGAAGCTTTTAGAAGCGGCACGAGCAGGTCAAGATGATGAAGTTCGTA TTTTGATGGCAAATGGAGCTCCCTTTACTACAGACTGGCTGGGAACTTCTCCACTTCATCTAGCAGCACA GTATGGTCATTATTCCACCACAGAGGTACTGCTGCGAGCTGGTGTGAGCAGAGATGCCAGAACCAAAGTG GACCGAACACCATTACATATGGCAGCTTCTGAGGGCCATGCCAGCATAGTAGAGGTTTTACTTAAGCATG GTGCTGATGTCAATGCAAAGGACATGTTAAAGATGACAGCTCTCCATTGGGCCACAGAACACAATCATCA AGAGGTGGTGGAACTTTTAATCAAATATGGTGCTGATGTACACACGCAAAGTAAATTTTGTAAAACTGCA TTTGATATTTCAATAGACAATGGAAATGAAGATTTAGCAGAGATATTACAGATTGCTATGCAGAACCAAA TCAACACAAACCCAGAGAGTCCTGACACTGTGACAATACATGCTGCAACACCACAGTTTATCATTGGACC TGGAGGGGTGGTGAACCTAACAGGTCTGGTATCTTCAGAAAATTCATCCAAGGCAACAGATGAAACGGGT GTATCTGCTGTTCAGTTTGGAAACTCTTCTACATCAGTATTAGCTACATTAGCTGCCTTAGCTGAAGCAT CTGCTCCATTGTCCAATTCTTCAGAAACTCCAGTAGTGGCCACAGAAGAAGTAGTTACTGCAGAATCTGT GGATGGTGCCATTCAGCAAGTAGTTAGTTCAGGGGGTCAGCAAGTCATCACAATAGTTACAGATGGAATT CAGCTTGGAAATTTGCACTCTATTCCAACCAGTGGAATTGGTCAGCCCATCATTGTGACCATGCCAGATG GACAACAAGTATTAACAGTACCAGCAACAGACATTGCTGAAGAAACTGTTATAAGTGAAGAACCACCAGC TAAGAGACAATGTATCGAAATAATTGAAAACCGGGTGGAATCTGCAGAAATAGAAGTAAGGAGTCTTTTA CCCGGTGTGCTTTGCCGCAGTCATCCAAAATAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_002041 |
Insert Size | 2740 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002041.1, NP_002032.1 |
RefSeq Size | 1658 bp |
RefSeq ORF | 1152 bp |
Locus ID | 2553 |
Cytogenetics | 15q21.2 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (gamma 1) uses an alternate in-frame splice site in the 3' coding region, compared to variant beta 1, resulting in a shorter isoform (gamma 1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC324667 | GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
USD 760.00 |
|
RC204396 | GABPB1 (Myc-DDK-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
USD 420.00 |
|
RG204396 | GABPB1 (GFP-tagged) - Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
USD 460.00 |
|
RC204396L3 | Lenti ORF clone of Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1, Myc-DDK-tagged |
USD 620.00 |
|
RC204396L4 | Lenti ORF clone of Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review