DUT (NM_001948) Human Untagged Clone

CAT#: SC118933

DUT (untagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DUT
• Synonyms: dUTPase
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001948, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCTGCTCTGAAGAGACACCCGCCATTTCACCCAGTAAGCGGGCCCGGCCTGCGGAGGTGGGCGGCA
  TGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGCCCCCACCCGGGGCTCCGCGCGCGCCGCGGG
  CTACGACCTGTACAGTGCCTATGATTACACAATACCACCTATGGAGAAAGCTGTTGTGAAAACGGACATT
  CAGATAGCGCTCCCTTCTGGGTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACACTTTA
  TTGATGTAGGAGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTACTGTTTAATTTTGG
  CAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGCGAACGGATTTTTTATCCA
  GAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAAGGGGTTCAGGAGGTTTTGGTTCCACTGGAAAGA
  ATTAA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_001948 unedited
  CACGAGGCGACGCTCATCGTGCGCTCTCCTCTTCCCCCGGTGGTCTCCTCGCTCGCCTTC
  TGGCTCTGCCATGCCCTGCTCTGAAGAGACACCCGCCATTTCACCCAGTAAGCGGGCCCG
  GCCTGCGGAGGTGGGCGGCATGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGC
  CCCCACCCGGGGCTCCGCGCGCGCCGCGGGCTACGACCTGTACAGTGCCTATGATTACAC
  AATACCACCTATGGAGAAAGCTGTTGTGAAAACGGACATTCAGATAGCGCTCCCTTCTGG
  GTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACACTTTATTGATGTAGG
  AGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTACTGTTTAATTTTGG
  CAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGCGAACGGAT
  TTTTTATCCAGAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001948
• Insert Size: 1600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001948.3, NP_001939.1
• RefSeq Size: 1874 bp
• RefSeq ORF: 495 bp
• Locus ID: 1854
• Cytogenetics: 15q21.1
• Domains: dUTPase
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Pyrimidine metabolism
• Gene Summary: 'This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2), also known as DUT-N, uses a different 5' exon, compared to variant 1. It encodes isoform 2, which has a shorter, distinct N-terminus that lacks the mitochondrial targeting sequence, compared to isoform 1.