HSBP1 (NM_001537) Human Untagged Clone

CAT#: SC119194

HSBP1 (untagged)-Human heat shock factor binding protein 1 (HSBP1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSBP1
• Synonyms: NPC-A-13
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001537, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGAGACTGACCCCAAGACCGTGCAGGACCTCACCTCGGTGGTGCAGACACTCCTGCAGCAGATGC
  AAGATAAATTTCAGACCATGTCTGACCAGATCATTGGGAGAATTGATGATATGAGTAGTCGCATTGATGA
  TCTGGAAAAGAATATCGCGGACCTCATGACACAGGCTGGGGTGGAAGAACTGGAAAGTGAAAACAAGATA
  CCTGCCACGCAAAAGAGTTGA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_001537 unedited
  GTTGCATTTGTATACGACTCCTATAGGCGGCCGCGNAATTCGCACGAGGGGAAGTGTAGG
  TTACGGTCTGAGACTCACCGCCAAGCTGGGCATCGGGGAGATGGCCGAGACTGACCCCAA
  GACCGTGCAGGACCTCACCTCGGTGGTGCAGACACTCCTGCAGCAGATGCAAGATAAATT
  TCAGACCATGTCTGACCAGATCATTGGGAGAATTGATGATATGAGTAGTCGCATTGATGA
  TCTGGAAAAGAATATCGCGGACCTCATGACACAGGCTGGGGTGGAAGAACTGGAAAGTGA
  AAACAAGATACCTGCCACGCAAAAGAGTTGAAGGTTGCTAATAATTTATACTGGAATCTG
  GCATTTTTCCAAGCCAAGAGAAGATCGAATGGCTTTTTGCAGCTAACTACTATGTGTAGA
  CAGGTTTTATATTATAAAGTATGCATTCTTATCACCTAGTATATAGTTAGTTTGTAGAGT
  GATTTCCCCCCAGTTTCTTGAACATGGTATCTTCACATCTTGGACCTTGGTCAGTTGTGC
  TATTCATTATTAAACACTAAAACTTTGGCGGTTCTTGCATAACATTGTCAGATTTTTTAG
  TGTATTTCTGTGAAGTCATTTTTTTTCTTGTCATTCCTTTTGTAGTAGTTGCTGTTTGGA
  TAAAAGTTGATGTGTGATTTTTTATTAAACAAATAGTAAACCCTTCAATTATAGTTAGTC
  TTGGTGAAGTAAGATGTTTGTAGACTTTAGAGTTCTTTAATTCTTGGCACAACGTGACTG
  TTGAGCTAACACCANATAGTGTGTTGGCAATACTTTTCAAATGGCTGAACACACCTAAAA
  ATTGTCATCCAGAATATCTGTCACTGCTCTGTTGCCAAACTCAGATAGAACTTANACTAT
  GTCTGAGTCCCTGAGATCACTGCTAAGTCGAT
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001537
• Insert Size: 1960 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001537.2, NP_001528.1
• RefSeq Size: 1919 bp
• RefSeq ORF: 231 bp
• Locus ID: 3281
• Cytogenetics: 16q23.3
• Protein Families: Transcription Factors
• Gene Summary: 'The heat-shock response is elicited by exposure of cells to thermal and chemical stress and through the activation of HSFs (heat shock factors) results in the elevated expression of heat-shock induced genes. Heat shock factor binding protein 1 (HSBP1), is a 76-amino-acid protein that binds to heat shock factor 1(HSF1), which is a transcription factor involved in the HS response. During HS response, HSF1 undergoes conformational transition from an inert non-DNA-binding monomer to active functional trimers. HSBP1 is nuclear-localized and interacts with the active trimeric state of HSF1 to negatively regulate HSF1 DNA-binding activity. Overexpression of HSBP1 in mammalian cells represses the transactivation activity of HSF1. When overexpressed in C.elegans HSBP1 has severe effects on survival of the animals after thermal and chemical stress consistent with a role of HSBP1 as a negative regulator of heat shock response. [provided by RefSeq, Jul 2008]'