BIRC5 (NM_001168) Human Untagged Clone

CAT#: SC119405

BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BIRC5
• Synonyms: API4; EPR-1
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001168 edited
  ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
  ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
  GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
  TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT
  TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA
  TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG
  AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC
  ATGGATTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001168
• Insert Size: 2700 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001168.2, NP_001159.2
• RefSeq Size: 2655 bp
• RefSeq ORF: 429 bp
• Locus ID: 332
• Cytogenetics: 17q25.3
• Domains: BIR
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Protein Pathways: Colorectal cancer, Pathways in cancer
• Gene Summary: 'This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011]'
  Transcript Variant: This variant (1) represents the most frequently occurring transcript and it encodes isoform 1.