RPL35A (NM_000996) Human Untagged Clone

CAT#: SC119503

RPL35A (untagged)-Human ribosomal protein L35a (RPL35A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL35A
• Synonyms: DBA5; eL33; L35A
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC119503 sequence for NM_000996 edited (data generated by NextGen Sequencing)
  ATGTCTGGAAGGCTGTGGTCCAAGGCCATTTTTGCTGGCTATAAGCGGGGTCTCCGGAAC
  CAAAGGGAGCACACAGCTCTTCTTAAAATTGAAGGTGTTTACGCCCGAGATGAAACAGAA
  TTCTATTTGGGCAAGAGATGCGCTTATGTATATAAAGCAAAGAACAACACAGTCACTCCT
  GGCGGCAAACCAAACAAAACCAGAGTCATCTGGGGAAAAGTAACTCGGGCCCATGGAAAC
  AGTGGCATGGTTCGTGCCAAATTCCGAAGCAATCTTCCTGCTAAGGCCATTGGACACAGA
  ATCCGAGTGATGCTGTACCCCTCAAGGATTTAA
  
  Clone variation with respect to NM_000996.2
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_000996 unedited
  TGTAATACGAACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTTGGCTCCTGTGGA
  GGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGAAGGCTGTGGTCCAAGGCC
  ATTTTTGCTGGCTATAAGCGGGGTCTCCGGAACCAAAGGGAGCACACAGCTCTTCTTAAA
  ATTGAAGGTGTTTACGCCCGAGATGAAACAGAATTCTATTTGGGCAAGAGATGCGCTTAT
  GTATATAAAGCAAAGAACAACACAGTCACTCCTGGCGGCAAACCAAACAAAACCAGAGTC
  ATCTGGGGAAAAGTAACTCGGGCCCATGGAAACAGTGGCATGGTTCGTGCCAAATTCCGA
  AGCAATCTTCCTGCTAAGGCCATTGGACACAGAATCCGAGTGATGCTGTACCCCTCAAGG
  ATTTAAACTAACGAAAAATCAATAAATAAATGTGGATTTGTGCTCTTGTATTTTTAAGTG
  GATTAAAAAACTTACTACCTTAAATTGATTTGCTACATGCTTAAAATGATAGAGGTTGCT
  CAGCATTTTTGGAGTACAAGGGGGTCAGAGAGACATGTGATGAAAATTANCAGGGCGAGT
  ACAGAGATTTAGAAGGGCAAACGGGTTTTAATGGCGAGTATCTTTNGACAGAGTCTTGCT
  CTGTTGCCCATCTGGANTGTTNNAAGGGGTGCTCGCTGCAGCCTACATTCAAAGGCTCAA
  GCAATCCTCCCTTGGCTTTTGAAGNTAGCTGGGAACACAGGCTCATGCACCATNCCTTGG
  GNTATTTNTAAAATTCTGTNNAAAAAAGAGGGTCTGACTCTTGCCTATGCTGCTTNCAAC
  TGCTGGCTCAGCAAATCTCTTCTTGCTTNCCTGAAAGGGCTGGGGAAAAAATTATGACCA
  CAACCTGCAGGGGGTTTGGATCTATGCATTGTCAAGGCGATGC
  
• Restriction Sites: NotI-NotI
• ACCN: NM_000996
• Insert Size: 1240 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000996.2, NP_000987.2
• RefSeq Size: 511 bp
• RefSeq ORF: 333 bp
• Locus ID: 6165
• Cytogenetics: 3q29
• Domains: Ribosomal_L35Ae
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L35AE family of ribosomal proteins. It is located in the cytoplasm. The rat protein has been shown to bind to both initiator and elongator tRNAs, and thus, it is located at the P site, or P and A sites, of the ribosome. Although this gene was originally mapped to chromosome 18, it has been established that it is located at 3q29-qter. Alternative splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Oct 2015]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.