GSTA2 (NM_000846) Human Untagged Clone

CAT#: SC119650

GSTA2 (untagged)-Human glutathione S-transferase alpha 2 (GSTA2)


  "NM_000846" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GSTA2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTA2
Synonyms GST2; GSTA2-2; GTA2; GTH2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000846 edited
ATGGCAGAGAAGCCCAAGCTCCACTACTCCAATATACGGGGCAGAATGGAGTCCATCCGG
TGGCTCCTGGCTGCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGAT
TTGGACAAGTTAAGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATT
GATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAAC
CTCTATGGGAAAGACATAAAGGAGAAAGCCCTGATTGATATGTATATAGAAGGTATAGCA
GATTTGGGTGAAATGATCCTTCTTCTGCCCTTTAGTCAACCTGAGGAACAAGATGCCAAG
CTTGCCTTGATCCAAGAGAAAACAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTA
AAGAGCCACGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCACCTG
GTGGAACTTCTCTACTACGTGGAAGAGCTTGACTCTAGCCTTATTTCCAGCTTCCCTCTG
CTGAAGGCCCTGAAAACCAGAATCAGTAACCTGCCCACAGTGAAGAAGTTTCTACAGCCT
GGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAATCAAGGAAGATTTTC
AGGTTTTAA
>OriGene 5' read for NM_000846 unedited
NCGTTCANCATTTGTNATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGATTTAAC
AAAGCTTANAGAAACCTCCAGNAGACTGCTACCATGGCAGAGAAGCCCAAGCTCCACTAC
TCCAATATACGGGGCAGAATGGAGTCCATCCGGTGGCTCCTGGCTGCAGCTGGAGTAGAG
TTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGATAT
TTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGA
GCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAAA
GCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTTCTTCTG
CCCTTTAGTCAACCTGAGGAACAAGATGCCAAGCTTGCCTTGATCCAAGAGAAAACAAAA
AATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCACGGACAAGACTACCTTGTT
GGCAACAAGCTGAGCCGGGCTGACATTCACCTGGTGGAACTTCTCTACTACGTGGAAGAG
CTTGACTCTAGCCTTATTTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGT
AACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGAT
GAGAAATCTTTAGAAAGATCAAGGAAGATTTTCAGGTTTTAATANACCAGCCATAGAGGT
CAAGAAACATGCAGACCAGTATTCTAAAGTTTTGCACAATTAAGTGCTTTACCTAAGTGT
TGATTGTGCCTGTTGTGAAGCTAATGAACTCTTTCAATTATATGCTATTTAATAATACAC
TCCTATTCACCACTTATTAAAATGATTC
Restriction Sites NotI-NotI     
ACCN NM_000846
Insert Size 3000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000846.3, NP_000837.2
RefSeq Size 976 bp
RefSeq ORF 669 bp
Locus ID 2939
Cytogenetics 6p12.2
Domains GST_N, GST_C
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.