Glutathione Peroxidase 1 (GPX1) (NM_000581) Human Untagged Clone

CAT#: SC119804

GPX1 (untagged)-Human glutathione peroxidase 1 (GPX1), transcript variant 1


  "NM_000581" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GPX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GPX1
Synonyms GPXD; GSHPX1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000581, the custom clone sequence may differ by one or more nucleotides


ATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCGGCCCAGTCGGTGTATGCCTTCTCGGCGCGCCCGC
TGGCCGGCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGTACTACTTATCGAGAATGTGGCGTC
CCTCTGAGGCACCACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGACCCCGGGGC
CTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTTGGGCATCAGGAGAACGCCAAGAACGAAGAGATTCTGA
ATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGT
GAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCC
ACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACT
TTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGA
CATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAG


>OriGene 5' read for NM_000581 unedited
TTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCCTGCTGGCCTC
CCCTTATAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGC
TGCTCGGCTAGCGGCGGCGGCGGCGGCCCAGTCGGTGTATGCCTTCTCGGCGCGCCCGCT
GGCCGGCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGTACTACTTATCGAGAA
TGTGGCGTCCCTCTGAGGCACCACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCG
GCGCCTCGGACCCCGGGGCCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTTGGGCATCA
GGAGAACGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGG
GTTCCAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGNGGCGCACCC
TCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTAT
GACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTT
TGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCA
GACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCTCAGCTGTGCCTA
GGGCGCCCCTNCCTACCCNGCTGCTNTGCAGNTGCAGTGCTGCTGTCTCGGNNGGGTTTT
CATCTATGAGGGGNTGTTNCCTCTAACCTACGAGGGNNAGACACCCTGATCTACAGAAAA
TCCACCTCGAGATGGNTGCTGGTCCCTGTGATCCCAGTCTCTGCCAGACCAGGCGAGTTC
NCCCACTATAAGGCGCCGGTTGTCAGCAGAAAAAAAAA
>OriGene 3' read for NM_000581 unedited
TTTTTTTTTTTTTTTTTCGGGGGCACCCCCGGCACTTTATTAGGGGGGAAACTCCCCTTG
GTCTGGCAAAAACTGGGATCAACAGGACCAGCCCCCATTTCGGAGGGGGTATTTTCTGTA
AAAACAGGGGTTCCTCCCTCGTAGGTTTAAAGGAAACACCCTCATAAATGAAAACCCCCC
CGAAACAGCAGCACTGCAACTGCCAAGCAGCCGGGGTAGGAGGGGCCCCCTAGGCACAGC
TGACCCCTTGAAACAGCAGGGCTTCAATGTCAGGCTCGATGTCAATGGTCTGGAAGCGGC
GGCTGTACCTGCGTAGGGGCACACCGTCAGGGCCCACCAGAAACTTTTAAAAGTTCCAGG
CAACATCGTTGCGACACACCGGAAACCAGGTGATGAGCTTGGGGTCGGTCATAAGCG
Restriction Sites NotI-NotI     
ACCN NM_000581
Insert Size 1000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000581.2, NP_000572.2
RefSeq Size 921 bp
RefSeq ORF 612 bp
Locus ID 2876
Cytogenetics 3p21.31
Domains GSHPx
Protein Families Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS), Arachidonic acid metabolism, Glutathione metabolism, Huntington's disease
Gene Summary 'The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. This gene contains an in-frame GCG trinucleotide repeat in the coding region, and three alleles with 4, 5 or 6 repeats have been found in the human population. The allele with 4 GCG repeats has been significantly associated with breast cancer risk in premenopausal women. Alternatively spliced transcript variants have been found for this gene. Pseudogenes of this locus have been identified on chromosomes X and 21. [provided by RefSeq, Aug 2017]'
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.