Cardiac Troponin I (TNNI3) (NM_000363) Human Untagged Clone

CAT#: SC119930

TNNI3 (untagged)-Human troponin I type 3 (cardiac) (TNNI3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNNI3
• Synonyms: CMD1FF; CMD2A; CMH7; cTnI; RCM1; TNNC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_000363, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGATGGGAGCAGCGATGCGGCTAGGGAACCTCGCCCTGCACCAGCCCCAATCAGACGCCGCTCCT
  CCAACTACCGCGCTTATGCCACGGAGCCGCACGCCAAGAAAAAATCTAAGATCTCCGCCTCGAGAAAATT
  GCAGCTGAAGACTCTGCTGCTGCAGATTGCAAAGCAAGAGCTGGAGCGAGAGGCGGAGGAGCGGCGCGGA
  GAGAAGGGGCGCGCTCTGAGCACCCGCTGCCAGCCACTGGAGTTGGCCGGGCTGGGCTTCGCGGAGCTGC
  AGGACTTGTGCCGACAGCTCCACGCCCGTGTGGACAAGGTGGATGAAGAGAGATACGACATAGAGGCAAA
  AGTCACCAAGAACATCACGGAGATTGCAGATCTGACTCAGAAGATCTTTGACCTTCGAGGCAAGTTTAAG
  CGGCCCACCCTGCGGAGAGTGAGGATCTCTGCAGATGCCATGATGCAGGCGCTGCTGGGGGCCCGGGCTA
  AGGAGTCCCTGGACCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAGGACACCGAGAAGGAAAACCGGGA
  GGTGGGAGACTGGCGCAAGAACATCGATGCACTGAGTGGAATGGAGGGCCGCAAGAAAAAGTTTGAGAGC
  TGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_000363
• Insert Size: 2250 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000363.2, NP_000354.2
• RefSeq Size: 866 bp
• RefSeq ORF: 1626 bp
• Locus ID: 7137
• Cytogenetics: 19q13.42
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency
• Protein Pathways: Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
• Gene Summary: 'Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]'