Decorin (DCN) (NM_133506) Human Untagged Clone

CAT#: SC120507

DCN (untagged)-Human decorin (DCN), transcript variant D


  "NM_133506" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DCN
Synonyms CSCD; DSPG2; PG40; PGII; PGS2; SLRR1B
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_133506, the custom clone sequence may differ by one or more nucleotides


ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCT
TATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGA
GCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTG
GGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAA
CCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGTTGTCTACCTTCATAACAACAATAT
CTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTG
AGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCT
CTGCCATTCAACTCGGAAACTATAAGTAA


>OriGene 5' read for NM_133506 unedited
TGGATTTAGGTATCACGACTCACTATAGGGNCGGACCGCGCAATTCGGCACGAGTTTCAA
CCTATTCACAGAGCAGCACCTACCCCCTCCTCCTTTCCCACCTGCAAACTCTTTTACTTG
GGCTGAATATTTAGTGTAATTACATCTCAGCTTTGAGGGCTCCTGTGGCAAATTCCCGGA
TTAAAAGGTTCCCTGGTTGTGAAAATACATGAGTTATTTTTATGAAGGCCACTATCATCC
TCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACT
TTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCG
AGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGT
GTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAG
ACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACC
TTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACAC
CTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAA
AAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAA
AAGTACTTTTCATGGACTGAACCAGATGATTGTCATAGAACTTGGCACCAATCCGCTGAA
GAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATTCGCAT
TGCTGATCCCATATCACCAGCATTCTCAGGTCTTACTCCTACCTTACCGAATACTCTTGA
TGGCACCAAATCACCAAATTGATGCACCTGCCTGAAGGACTGAAAATATTGCTAAGTGGG
ATTGGTTTAACGCCTC
Restriction Sites NotI-NotI     
ACCN NM_133506
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133506.2, NP_598013.1
RefSeq Size 1336 bp
RefSeq ORF 519 bp
Locus ID 1634
Cytogenetics 12q21.33
Domains LRRNT, LRR
Protein Families Druggable Genome, Secreted Protein
Protein Pathways TGF-beta signaling pathway
Gene Summary 'This gene encodes a member of the small leucine-rich proteoglycan family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. This protein plays a role in collagen fibril assembly. Binding of this protein to multiple cell surface receptors mediates its role in tumor suppression, including a stimulatory effect on autophagy and inflammation and an inhibitory effect on angiogenesis and tumorigenesis. This gene and the related gene biglycan are thought to be the result of a gene duplication. Mutations in this gene are associated with congenital stromal corneal dystrophy in human patients. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (D) differs in the 5' UTR and lacks four alternate exons in the coding region compared to variant A1. The encoded isoform (d) is shorter than isoform a. This isoform (d) may undergo proteolytic processing similar to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.