S100 alpha 2 (S100A2) (NM_005978) Human Untagged Clone

CAT#: SC121135

S100A2 (untagged)-Human S100 calcium binding protein A2 (S100A2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: S100A2
• Synonyms: CAN19; S100L
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC121135 sequence for NM_005978 edited (data generated by NextGen Sequencing)
  ATGTGCAGTTCTCTGGAGCAGGCGCTGGCTGTGCTGGTCACTACCTTCCACAAGTACTCC
  TGCCAAGAGGGCGACAAGTTCAAGCTGAGTAAGGGGGAAATGAAGGAACTTCTGCACAAG
  GAGCTGCCCAGCTTTGTGGGGGAGAAAGTGGATGAGGAGGGGCTGAAGAAGCTGATGGGC
  AGCCTGGATGAGAACAGTGACCAGCAGGTGGACTTCCAGGAGTATGCTGTTTTCCTGGCA
  CTCATCACTGTCATGTGCAATGACTTCTTCCAGGGCTGCCCAGACCGACCCTGA
  
  Clone variation with respect to NM_005978.3
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_005978 unedited
  AAGACGTCAGGATTTGTATACGACTTACTATAGGCGGCCGCGCAATTCGCACGAGGCTCC
  CCTCACCCCGGTCCAGGATGCCCAGTCCCCACGACACCTCCCACTTCCCACTGTGGCCTG
  GGTGGGCTCAGGGGCTGCCCTTGACCTGGCCTAGAGCCCTCCCCCAGCTGGTGGTGGAGC
  TGGCACTCTCTGGGAGGGAGGGGGCTGGGAGGGAATGAGTGGGAATGGCAAGAGGCCAGG
  GTTTGGTGGGATCAGGTTGAGGCAGGTTTGGTTTCCTTAAAATGCCAAGTTGGGGGCCAG
  TGGGGCCCACATATAAATCCTCACCCTGGGAGCCTGGCTGCCTTGCTCTCCTTCCTGGGT
  CTGTCTCTGCCACCTGGTCTGCCACAGATCCATGATGTGCAGTTCTCTGGAGCAAGCGCT
  GGCTGTGCTGGTCACTACCTTCCACAAGTACTCCTGCCAAGAGGGCGACAAGTTCAAGCT
  GAGTAAGGGGGAAATGAAGGAACTTCTGCACAAGGAGCTGCCCAGCTTTGTGGGGGAGAA
  AGTGGATGAGGAGGGGCTGAAGAAGCTGATGGGCAGCCTGGATGAGAACAGTGACCAGCA
  GGTGGACTTCCAGGAGTATGCTGTTTTCCTGGCACTCATCACTGTCATGTGCAATGACTT
  CTTCCAGGGCTGCCCAGACCGACCCTGAAGCAGAACTCTTGACTTCCTGCCATGGATCTT
  TTGGGCCCAAGACTGTTGATGCCTTTGAGTTTTGGATTCAATAAACTTTTTTTGTCTGTT
  GAANAAAAAAAATNAGAAAAAATTCCTCGACTCTAGATTTGCGCCGCGGTCATAGCTGTT
  TCCCTGACAGATTCAG
  
• Restriction Sites: Please inquire
• ACCN: NM_005978
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005978.3, NP_005969.1
• RefSeq Size: 970 bp
• RefSeq ORF: 294 bp
• Locus ID: 6273
• Cytogenetics: 1q21.3
• Gene Summary: 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may have a tumor suppressor function. Chromosomal rearrangements and altered expression of this gene have been implicated in breast cancer. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to extend the N-terminus to one that is more supported by available proteomics data.