Noggin (NOG) (NM_005450) Human Untagged Clone

CAT#: SC122718

NOG (untagged)-Human noggin (NOG)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NOG
• Synonyms: SYM1; SYNS1; SYNS1A
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005450, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCGCTGCCCCAGCCTAGGGGTCACCCTCTACGCCCTGGTGGTGGTCCTGGGGCTGCGGGCGACAC
  CGGCCGGCGGCCAGCACTATCTCCACATCCGCCCGGCACCCAGCGACAACCTGCCCCTGGTGGACCTCAT
  CGAACACCCAGACCCTATCTTTGACCCCAAGGAAAAGGATCTGAACGAGACGCTGCTGCGCTCGCTGCTC
  GGGGGCCACTACGACCCAGGCTTCATGGCCACCTCGCCCCCCGAGGACCGGCCCGGCGGGGGCGGGGGTG
  CAGCTGGGGGCGCGGAGGACCTGGCGGAGCTGGACCAGCTGCTGCGGCAGCGGCCGTCGGGGGCCATGCC
  GAGCGAGATCAAAGGGCTAGAGTTCTCCGAGGGCTTGGCCCAGGGCAAGAAGCAGCGCCTAAGCAAGAAG
  CTGCGGAGGAAGTTACAGATGTGGCTGTGGTCGCAGACATTCTGCCCCGTGCTGTACGCGTGGAACGACC
  TGGGCAGCCGCTTTTGGCCGCGCTACGTGAAGGTGGGCAGCTGCTTCAGTAAGCGCTCGTGCTCCGTGCC
  CGAGGGCATGGTGTGCAAGCCGTCCAAGTCCGTGCACCTCACGGTGCTGCGGTGGCGCTGTCAGCGGCGC
  GGGGGCCAGCGCTGCGGCTGGATTCCCATCCAGTACCCCATCATTTCCGAGTGCAAGTGCTCGTGCTAG
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_005450
• ORF Size: 699 bp
• Insert Size: 1300
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005450.2.

Reference Data

• RefSeq: NM_005450.4, NP_005441.1
• RefSeq Size: 1892
• RefSeq ORF: 699
• Locus ID: 9241
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: TGF-beta signaling pathway
• Gene Summary: The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]