Noggin (NOG) (NM_005450) Human Untagged Clone

CAT#: SC122718

NOG (untagged)-Human noggin (NOG)


  "NM_005450" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NOG
Synonyms SYM1; SYNS1; SYNS1A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_005450, the custom clone sequence may differ by one or more nucleotides


ATGGAGCGCTGCCCCAGCCTAGGGGTCACCCTCTACGCCCTGGTGGTGGTCCTGGGGCTGCGGGCGACAC
CGGCCGGCGGCCAGCACTATCTCCACATCCGCCCGGCACCCAGCGACAACCTGCCCCTGGTGGACCTCAT
CGAACACCCAGACCCTATCTTTGACCCCAAGGAAAAGGATCTGAACGAGACGCTGCTGCGCTCGCTGCTC
GGGGGCCACTACGACCCAGGCTTCATGGCCACCTCGCCCCCCGAGGACCGGCCCGGCGGGGGCGGGGGTG
CAGCTGGGGGCGCGGAGGACCTGGCGGAGCTGGACCAGCTGCTGCGGCAGCGGCCGTCGGGGGCCATGCC
GAGCGAGATCAAAGGGCTAGAGTTCTCCGAGGGCTTGGCCCAGGGCAAGAAGCAGCGCCTAAGCAAGAAG
CTGCGGAGGAAGTTACAGATGTGGCTGTGGTCGCAGACATTCTGCCCCGTGCTGTACGCGTGGAACGACC
TGGGCAGCCGCTTTTGGCCGCGCTACGTGAAGGTGGGCAGCTGCTTCAGTAAGCGCTCGTGCTCCGTGCC
CGAGGGCATGGTGTGCAAGCCGTCCAAGTCCGTGCACCTCACGGTGCTGCGGTGGCGCTGTCAGCGGCGC
GGGGGCCAGCGCTGCGGCTGGATTCCCATCCAGTACCCCATCATTTCCGAGTGCAAGTGCTCGTGCTAG


Restriction Sites SgfI-RsrII     
ACCN NM_005450
ORF Size 699 bp
Insert Size 1300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005450.2.
Reference Data
RefSeq NM_005450.4, NP_005441.1
RefSeq Size 1892
RefSeq ORF 699
Locus ID 9241
Protein Families Druggable Genome, Secreted Protein
Protein Pathways TGF-beta signaling pathway
Gene Summary The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.