Ribosomal Protein S29 (RPS29) (BC035313) Human Untagged Clone

CAT#: SC123468

RPS29 (untagged)-Human ribosomal protein S29 (cDNA clone MGC:9279 IMAGE:3868721), complete cds


Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RPS29"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPS29
Synonyms DBA13|S29
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC035313 edited
GCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTC
GCTCTTGTCGTGTCTGTTCAAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGT
GCCGCCAGTGTTTCCGTCAGTACGCGAAGGATATCGGTTTCATTAAGTTGGACTAAATGC
TCTTCCTTCAGAGGATTATCCGGGGCATCTACTCAATGAAAAACCATGATAATTCTTTGT
ATATAAAATAAACATTTGAAAAAACCCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for BC035313 unedited
GCCAGAATTTTGTAATACGAACTCACTATAGGGCGGCCGCGATTCCCGGGATATCGTCGA
CCCACGCGTCCGCGGACGCGTGGGTCGCCCACGCGTCCGGCAAGATGGGTCACCAGCAGC
TGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTCGTGTCTGTTCAA
ACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGT
ACGCGAAGGATATCGGTTTCATTAAGTTGGACTAAATGCTCTTCCTTCAGAGGATTATCC
GGGGCATCTACTCAATGAAAAACCATGATAATTCTTTGTATATAAAATAAACATTTGAAA
AAACCCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGCCGCGGTCATA
GCTGTTTCCTGAACAAATCCCGGGGGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTG
GCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATC
ATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGGTTTGGAC
CAAGGGGCAATTTTGGGAAAACAACCTGTGGGCCTGGGGTGTCTATTGGGAACCAAGCTG
GGTGCAGGGGCCAATTCTTGGCTCATGGAATCTACCCCTCCTGGGTAAAGCAATTTTCTG
GCTTAACCTTCCAATTTTTGGGTTTCCGGGCGGGCTGACAGGCCTAACTAATTTTTTTTT
TTGTGAGAAGCGGGGGTTCCCAATTTGTGCCGGTGGGGCCCAACTCCTAATTCGGGGGAT
ATCCCCCTGGGCTCCCAAATTGCTGGGAAA
Restriction Sites Please inquire     
ACCN BC035313
Insert Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC035313.1, AAH35313.1
RefSeq Size 348 bp
Locus ID 6235
Cytogenetics 14q21.3
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.