PKC alpha (PRKCA) (BC011942) Human Untagged Clone

CAT#: SC123660

(untagged)-Homo sapiens, clone MGC:20828 IMAGE:4336144, complete cds


Reconstitution Protocol

USD 960.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PRKCA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRKCA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC011942 edited
GGCACGAGGAGTTTTGTTACCCAGGCTGGATTTCGGTGGTGGGATCTTGGCTCACTGCAA
AGAAATGAACAAAAATTCAGGCAACGTAGTGAGACTCTGTCTCCTGCGGTTGATACCTGT
TCTACCTCCCATGGCTACTCTTGCTCCCTTCCCATTTGCAGGGGCTGTTAGGACTCCACT
GAACAGTTCAGTGCCTTTTTATTGAGTGCCTATGAGATGCCAGGCCCTGTCCTGGGTATT
GTGGGCACTGTGGAGCGAGATGTCTTTGACCCTAAAGAGCTTTTATTCCAGTTCAGGGAG
AGAGACTAGGCGAGACATGAAATATACAGGGTCACAGGAGTCTCAGTGGACTGGGGTCAG
GAGAATTGCTTGAACCTGGGAGGTGGAGGTTGCGGTGAGCCGAGATTGCACCAGTGCACT
CCAGCCTGGGCAACAAGAGCGAAACTCCATCTCAAAAAAACAAAACAACAACAACAATAA
AAAAAAAAAAAAAAAA
>OriGene 5' read for BC011942 unedited
GTCAAAATTTGTAAACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGAGTTTTGTTA
CCCAGGCTGGATTTCGGTGGTGGGATCTTGGCTCACTGCAAAGAAATGAACAAAAATTCA
GGCAACGTAGTGAGACTCTGTCTCCTGCGGTTGATACCTGTTCTACCTCCCATGGCTACT
CTTGCTCCCTTCCCATTTGCAGGGGCTGTTAGGACTCCACTGAACAGTTCAGTGCCTTTT
TATTGAGTGCCTATGAGATGCCAGGCCCTGTCCTGGGTATTGTGGGCACTGTGGAGCGAG
ATGTCTTTGACCCTAAAGAGCTTTTATTCCAGTTCAGGGAGAGAGACTAGGCGAGACATG
AAATATACAGGGTCACAGGAGTCTCAGTGGACTGGGGTCAGGAGAATTGCTTGAACCTGG
GAGGTGGAGGTTGCGGTGAGCCGAGATTGCACCAGTGCACTCCAGCCTGTGCAACAAGAG
CGAAACTCCATCTCANANAAACAAAACAACAACCACAATAAAAAAAAAAAAAAAAAACTC
GAGTTTTTTTTTTTTTTTTTTTTTTAAATTTTTTTAAACACCTGCTTTTCGATTGGCTGA
AATCTGTGTTCACGAGTAGCACAGTCTACTTTGCCCGATATAGATTATAGAAGTTAGCTC
TTGCGTTTTACTAGGATCAAACACTTTCCTTCTTCTAAACAAGTTTTTAATACCTCCCTG
CCTCTGGGATGTGAATGCAAGGCACCAAACCTCGGCCCAAGGCTAAAACCCACTCTTCCG
GGCTGGTCCCCATTTTCGGGGGCCCAGGGCACCCCCTCCCTCGCAAGGGCAACTCCCCCA
ACGGGTCCGGGCCGTTCCCCCGGTTACCTGGAGGCGGGCTGGGATACTAACCCCCAAATC
TTGGATTTGCGGGCAACCGCCCCT
Restriction Sites Please inquire     
ACCN BC011942
Insert Size 496 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC011942.1, AAH11942.1
RefSeq Size 496 bp
Locus ID 5578
Cytogenetics 17q24.2
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Calcium signaling pathway, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Leukocyte transendothelial migration, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Natural killer cell mediated cytotoxicity, Non-small cell lung cancer, Pathogenic Escherichia coli infection, Pathways in cancer, Phosphatidylinositol signaling system, Tight junction, Vascular smooth muscle contraction, VEGF signaling pathway, Vibrio cholerae infection, Wnt signaling pathway
Gene Summary 'Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.