IL12RB1 (NM_153701) Human Untagged Clone

CAT#: SC123857

IL12RB1 (untagged)-Human interleukin 12 receptor, beta 1 (IL12RB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL12RB1
• Synonyms: CD212; IL-12R-BETA1; IL12RB; IMD30
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153701, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCGCTGGTGACCTGGGTGGTCCCCCTCCTCTTCCTCTTCCTGCTGTCCAGGCAGGGCGCTGCCT
  GCAGAACCAGTGAGTGCTGTTTTCAGGACCCGCCATATCCGGATGCAGACTCAGGCTCGGCCTCGGGCCC
  TAGGGACCTGAGATGCTATCGGATATCCAGTGATCGTTACGAGTGCTCCTGGCAGTATGAGGGTCCCACA
  GCTGGGGTCAGCCACTTCCTGCGGTGTTGCCTTAGCTCCGGGCGCTGCTGCTACTTCGCCGCCGGCTCAG
  CCACCAGGCTGCAGTTCTCCGACCAGGCTGGGGTGTCTGTGCTGTACACTGTCACACTCTGGGTGGAATC
  CTGGGCCAGGAACCAGACAGAGAAGTCTCCTGAGGTGACCCTGCAGCTCTACAACTCAGTTAAATATGAG
  CCTCCTCTGGGAGACATCAAGGTGTCCAAGTTGGCCGGGCAGCTGCGTATGGAGTGGGAGACCCCGGATA
  ACCAGGTTGGTGCTGAGGTGCAGTTCCGGCACCGGACACCCAGCAGCCCATGGAAGTTGGGCGACTGCGG
  ACCTCAGGATGATGATACTGAGTCCTGCCTCTGCCCCCTGGAGATGAATGTGGCCCAGGAATTCCAGCTC
  CGACGACGGCAGCTGGGGAGCCAAGGAAGTTCCTGGAGCAAGTGGAGCAGCCCCGTGTGCGTTCCCCCTG
  AAAACCCCCCACAGCCTCAGGTGAGATTCTCGGTGGAGCAGCTGGGCCAGGATGGGAGGAGGCGGCTGAC
  CCTGAAAGAGCAGCCAACCCAGCTGGAGCTTCCAGAAGGCTGTCAAGGGCTGGCGCCTGGCACGGAGGTC
  ACTTACCGACTACAGCTCCACATGCTGTCCTGCCCGTGTAAGGCCAAGGCCACCAGGACCCTGCACCTGG
  GGAAGATGCCCTATCTCTCGGGTGCTGCCTACAACGTGGCTGTCATCTCCTCGAACCAATTTGGTCCTGG
  CCTGAACCAGACGTGGCACATTCCTGCCGACACCCACACAGATGGCATGATCTCAGCTCACTGCAACCTC
  CGCCTTCCAGATTCAAGAGATTCTCCTGCTTCAGCCTCCCGAGTAGCTGGGATTACAGGCATCTGCCACC
  ATACCCGGCTAATTTTGTATTTTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153701
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_153701.2, NP_714912.1
• RefSeq Size: 1997 bp
• RefSeq ORF: 1146 bp
• Locus ID: 3594
• Cytogenetics: 19p13.11
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: 'The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
  Transcript Variant: This variant (2) represents the use of an alternate promoter, differs in the 5' UTR and has a different 3' structure which results in a translational frameshift and an early stop codon compared to variant 4. The encoded isoform (2) has a shorter N-terminus and a distinct C-terminus compared to isoform 4. Sequence Note: The 5' UTR was inferred from partial sequence data.