MRPL33 (NM_145330) Human Untagged Clone

CAT#: SC124322

MRPL33 (untagged)-Human mitochondrial ribosomal protein L33 (MRPL33), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_145330" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MRPL33"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRPL33
Synonyms C2orf1; L33mt; MRP-L33; RPL33L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_145330, the custom clone sequence may differ by one or more nucleotides


ATGTTCCTCTCCGCGGTCTTCTTTGCCAAGAGCAAGTCAAATGAAACAAAGAGTCCTCTTCGTGGAAAAG
AAAAAAATACGCTCCCTTTAAACGGTGGATTGAAAATGACTTTGATTTATAAAGAGAAGACTGAGGGCGG
GGATACTGATTCAGAAATCCTGTAG


>OriGene 5' read for NM_145330 unedited
CACGAGAACTGCCCGGTGTGGTCACCATGTTCCTCTCCGCGGTCTTCTTTGCCAAGAGCA
AGTCAAATGAAACAAAGAGTCCTCTTCGTGGAAAAGAAAAAAATACGCTCCCTTTTAAAC
GGTGGATTGAAAATGACTTTGATTTATAAAGAAAAAACTGAGGGCGGGGATACTGATTCA
GAAATCCTGTAGCGTGTAATAAAAGAAGAGGAAATGGCATGGAATCACTGCCTCCTGTGA
TTTGAAGGCCATTGTGAAGGAAAACAATGCAGTGAAAGAAAGTTCTTCATATTAGGACAG
ATATCATTGCATCACATTTATTTATCTTTCTGGGTATTTTTATAGCCCTTAATAAAAAAT
ATTAAAATAAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTG
TTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCT
TTGGAAGTTGCCACTCCAGTGCCCAC
Restriction Sites NotI-NotI     
ACCN NM_145330
ORF Size 165 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_145330.1, NP_663303.1
RefSeq Size 434
RefSeq ORF 165
Locus ID 9553
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an internal segment, compared to variant 1, that causes a frameshift. It is not known if a protein product is made from this variant.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.