MRPS12 (NM_033363) Human Untagged Clone
CAT#: SC124434
MRPS12 (untagged)-Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3
"NM_033363" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPS12 |
Synonyms | MPR-S12; MT-RPS12; RPMS12; RPS12; RPSM12 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_033363, the custom clone sequence may differ by one or more nucleotides
ATGTCCTGGTCTGGCCTTCTCCATGGCCTCAACACGTCCCTAACTTGTGGCCCAGCTCTGGTTCCCCGGC TCTGGGCTACCTGCTCCATGGCTACCCTGAACCAGATGCACCGCCTGGGGCCCCCCAAGCGGCCGCCTCG GAAGCTGGGCCCCACGGAAGGCCGGCCGCAGCTGAAGGGTGTGGTCCTGTGCACGTTTACCCGCAAGCCG AAGAAGCCCAACTCAGCCAATCGCAAGTGCTGTCGAGTGCGGCTCAGCACTGGCCGCGAGGCCGTCTGCT TCATCCCTGGGGAGGGCCACACCCTGCAGGAGCACCAGATTGTCCTTGTGGAGGGCGGCCGCACCCAGGA CCTGCCAGGCGTCAAGCTCACCGTTGTGCGTGGCAAGTACGACTGTGGCCACGTGCAGAAGAAGTGA >OriGene 5' read for NM_033363 unedited
CACCAGGCTGGNATCAGCGTGTCCGCGACCTCACCTTTAGGTCCTGTGAGGGACGGCCCA GGTGGCAGGATGTCCTGGTCTGGCCTTCTCCATGGCCTCAACACGTCCCTAACTTGTGGC CCAGCTCTGGTTCCCCGGCTCTGGGCTACCTGCTCCATGGCTACCCTGAACCAGATGCAC CGCCTGGGGCCCCCCAAGCGGCCGCCTCGGAAGCTGGGCCCCACGGAAGGCCGGCCGCAG CTGAAGGGTGTGGTCCTGTGCACGTTTACCCGCAAGCCGAAGAAGCCCAACTCAGCCAAT CGCAAGTGCTGTCGAGTGCGGCTCAGCACTGGCCGCGAGGCCGTCTGCTTCATCCCTGNG GAGGGCCACACCCTGCAGGAGCACCAGATTGTCCTTGTGGAGGGCGGCCGCACCCAGGAC CTGCCAGGCGTCAAGCTCACCGTTGTGCGTGGCAAGTACGACTGTGGCCA |
Restriction Sites | NotI-NotI |
ACCN | NM_033363 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033363.1, NP_203527.1 |
RefSeq Size | 991 bp |
RefSeq ORF | 417 bp |
Locus ID | 6183 |
Cytogenetics | 19q13.2 |
Domains | Ribosomal_S12 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | 'Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S12P family. The encoded protein is a key component of the ribosomal small subunit and controls the decoding fidelity and susceptibility to aminoglycoside antibiotics. The gene for mitochondrial seryl-tRNA synthetase is located upstream and adjacent to this gene, and both genes are possible candidates for the autosomal dominant deafness gene (DFNA4). Splice variants that differ in the 5' UTR have been found for this gene; all three variants encode the same protein. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) contains a shorter 5' UTR when compared to variant 1. Variants 1, 2, and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC320703 | MRPS12 (untagged)-Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 310.00 |
|
RC200593 | MRPS12 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 420.00 |
|
RG200593 | MRPS12 (GFP-tagged) - Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 460.00 |
|
RC200593L3 | Lenti-ORF clone of MRPS12 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
|
RC200593L4 | Lenti-ORF clone of MRPS12 (mGFP-tagged)-Human mitochondrial ribosomal protein S12 (MRPS12), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review