HMGA1 (NM_145901) Human Untagged Clone

CAT#: SC124566

HMGA1 (untagged)-Human high mobility group AT-hook 1 (HMGA1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HMGA1
• Synonyms: HMG-R; HMGA1A; HMGIY
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145901, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGAGTCGAGCTCGAAGTCCAGCCAGCCCTTGGCCTCCAAGCAGGAAAAGGACGGCACTGAGAAGC
  GGGGCCGGGGCAGGCCGCGCAAGCAGCCTCCGGTGAGTCCCGGGACAGCGCTGGTAGGGAGTCAGAAGGA
  GCCCAGCGAAGTGCCAACACCTAAGAGACCTCGGGGCCGACCAAAGGGAAGCAAAAACAAGGGTGCTGCC
  AAGACCCGGAAAACCACCACAACTCCAGGAAGGAAACCAAGGGGCAGACCCAAAAAACTGGAGAAGGAGG
  AAGAGGAGGGCATCTCGCAGGAGTCCTCGGAGGAGGAGCAGTGA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_145901 unedited
  NNGGGCCATATCCCCCGCCCGTTGCCGCTTTGGGCGGTAGGCGTGTACGGTGGGAGGTCT
  ATATAAGCAGTTCTCATTTAGGTGACACTATAGGAGACAGGCTACTTGCTCTTTTTGCAG
  CGGCCGCGAATTCGGCACGAGGCTCCGGTGAGTCCCGGGACAGCGCTGGTAGGGAGTCAG
  AAGGAGCCCAGCGAAGTGCCAACACCTAAGAGACCTCGGGGCTCGACCAAAGGGAAGCAA
  AAACAAGGGTGCTGGGGGACCCGGAAAACCACCACAACTCCAGGAAGGAAACCAAGGGGC
  AGACCCAAAAAACTGGAGAAGGAGGAAGAGGAGGGCATCTCGCAGGAGTCCTCGGAGGAG
  GAGCAGTGACCCATGCGTGCCGCCTGCTCCTCACTGGAGGAGCAGCTTCCTTCTGGGACT
  GGACAGCTTTGCTCCGCTCCCACCGCCCCCGCCCCTTCCCCAGGCCCACCATCACCACCG
  CCTCTGGCCGCCACCCCCATCTTCCACCTGTGCCCTCACCACCACACTACACAGCACACC
  AGCCGCTGCAGGGCTCCCATGGGCTGAGTGGGGAGCAGTTTTCCCCTGGCCTCAGTTCCC
  AGCTCCCCCCGCCCACCCACGCATACACACATGCCCTCCTGGACAAGGCTAACATCCCAC
  TTAGCCGCACCCTGCACCTGCTGCGTCCCCACTCCCTTGGTGGTGGGGACATTGCTCTCT
  GGGCTTTTGGTTTGGGGGCGCCCTCTCTGCTCCTTCACTGGTCCCTCTGGCTTCCATAGG
  GGGCCTGGGGAGGGTTCCCCTGGCCTTAAAGGGGCCCAAGCCCCACTCATCCTGGCACGC
  CTACTCCACTGCCTGGCACAGCAGGTGGGCCATGGAAGGGG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_145901
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_145901.1, NP_665908.1
• RefSeq Size: 1876 bp
• RefSeq ORF: 324 bp
• Locus ID: 3159
• Cytogenetics: 6p21.31
• Protein Families: Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - JAK/STAT signaling pathway, Transcription Factors
• Gene Summary: 'This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes. [provided by RefSeq, Jan 2016]'
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 3, 9, 10, 12, and 13 encode isoform (a, also called HMG-I). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.