Microsomal Glutathione S transferase 1 (MGST1) (NM_145764) Human Untagged Clone

CAT#: SC124599

MGST1 (untagged)-Human microsomal glutathione S-transferase 1 (MGST1), transcript variant 1d


  "NM_145764" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MGST1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MGST1
Synonyms GST12; MGST; MGST-I
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_145764, the custom clone sequence may differ by one or more nucleotides


ATGGTTGACCTCACCCAGGTAATGGATGATGAAGTATTCATGGCTTTTGCATCCTATGCAACAATTATTC
TTTCAAAAATGATGCTTATGAGTACTGCAACTGCATTCTATAGATTGACAAGAAAGGTTTTTGCCAATCC
AGAAGACTGTGTAGCATTTGGCAAAGGAGAAAATGCCAAGAAGTATCTTCGAACAGATGACAGAGTAGAA
CGTGTACGCAGAGCCCACCTGAATGACCTTGAAAATATTATTCCATTTCTTGGAATTGGCCTCCTGTATT
CCTTGAGTGGTCCCGACCCCTCTACAGCCATCCTGCACTTCAGACTATTTGTCGGAGCACGGATCTACCA
CACCATTGCATATTTGACACCCCTTCCCCAGCCAAATAGAGCTTTGAGTTTTTTTGTTGGATATGGAGTT
ACTCTTTCCATGGCTTACAGGTTGCTGAAAAGTAAATTGTACCTGTAA


>OriGene 5' read for NM_145764 unedited
NTTGTCAGAAATTTGTAATACGACTCACTTATAGGGCGGCCGCGAATCGGCACGAGGCTG
CTTCCTCCTCCTCGGCCTCACCATTCCAGACAAAATGAAAAAAGGTTGACCTCACCCAGG
TAATGGATGATGAAGTATTCATGGCTTTTGCATCCTATGCAACAATTATTCTTTCAAAAA
TGATGCTTATGAGTACTGCAACTGCATTCTATAGATTGACAAGAAAGGTTTTTGCCAATC
CAGAAGACTGTGTAGCATTTGGCAAAGGAGAAAATGCCAAGAAGTATCTTCGAACAGATG
ACAGAGTAGAACGTGTACGCAGAGCCCACCTGAATGACCTTGAAAATATTATTCCATTTC
TTGGAATTGGCCTCCTGTATTCCTTGAGTGGTCCCGACCCCTCTACAGCCATCCTGCACT
TCAGACTATTTGTCGGAGCACGGATCTACCACACCATTGCATATTTGACACCCCTTCCCC
AGCCAAATAGAGCTTTGAGTTTTTTTGTTGGATATGGAGTTACTCTTTCCATGGCTTACA
GGTTGCTGAAAAGTAAATTGTACCTGTAAAGAAAATCATACAACTCAACATCCAGTTGGC
TTTTTAAGAATTCTGTACTTCCAATTTATAATGAATACTTTCTTAGATTTTAGGTAGGAG
GGGAGCAGAGGAATTATGAACTGGGGTAAACCCATTTTGAATATTAGCATTGCCAATATC
CTGTATTCTTGNTNTACATTTGGATTAGAAATTTAACATAGTAATTCTTAAGTCTTTTGT
CTGATTNTTAAGTACTNTCTTATAATTNGNATCATGTTATGATTNGTAACATTCACACAC
ACCTCACTTTTGAATCTATNANAGAAATGCACGTATGAGAAACCCTATATTCATACTGCT
GAAACAGACTG
Restriction Sites NotI-NotI     
ACCN NM_145764
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145764.1, NP_665707.1
RefSeq Size 917 bp
RefSeq ORF 468 bp
Locus ID 4257
Cytogenetics 12p12.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]'
Transcript Variant: This variant (4, also called 1d) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.