UBE2I (NM_194261) Human Untagged Clone

CAT#: SC124667

UBE2I (untagged)-Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4


  "NM_194261" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "UBE2I"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2I
Synonyms C358B7.1; P18; UBC9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC124667 sequence for NM_194261 edited (data generated by NextGen Sequencing)
ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC
CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC
TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA
CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA
TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC
AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA
AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAAC
AGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA

Clone variation with respect to NM_194261.2
Restriction Sites NotI-NotI     
ACCN NM_194261
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_194261.1, NP_919237.1
RefSeq Size 1177 bp
RefSeq ORF 477 bp
Locus ID 7329
Cytogenetics 16p13.3
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.