NIPP1 (PPP1R8) (NM_002713) Human Untagged Clone

CAT#: SC124701

PPP1R8 (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 8 (PPP1R8), transcript variant 3


  "NM_002713" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PPP1R8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP1R8
Synonyms ARD-1; ARD1; NIPP-1; NIPP1; PRO2047
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC124701 sequence for NM_002713 edited (data generated by NextGen Sequencing)
ATGGTGCAAACTGCAGTGGTCCCAGTCAAGAAGAAGCGTGTGGAGGGCCCTGGCTCCCTG
GGCCTGGAGGAATCAGGGAGCAGGCGCATGCAGAACTTTGCCTTCAGCGGAGGACTCTAC
GGGGGCCTGCCCCCCACACACAGTGAAGCAGGCTCCCAGCCACATGGCATCCATGGGACA
GCACTCATCGGTGGCTTGCCCATGCCATACCCAAACCTTGCCCCTGATGTGGACTTGACT
CCTGTTGTKCCGTCAGCAGTGAACATGAACCCTGCACCAAACCCTGCAGTCTATAACCCT
GAAGCTGTAAATGAACCCAAGAAGAAGAAATATGCAAAAGAGGCTTGGCCAGGCAAGAAG
CCCACACCTTCCTTGCTGATTTGA

Clone variation with respect to NM_002713.3
249 g=>k
>OriGene 5' read for NM_002713 unedited
NNNCCAGGTCAAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGCGG
CAGCCGCGAACTCCGGCTCTAGCCTCCCGCTGTTCGACTGCCCAACCTGGGCAGGTAAGC
CCCCTCCCGGTTTACATCTGGATGTAGTCAAAGGAGACAAACTAATTGAGAAACTGATTA
TTGATGAGAAGAAGTATTACTTATTTGGGAGAAACCCTGATTTGTGTGACTTTACCATTG
ACCACCAGTCTTGCTCTCGGGTCCATGCTGCACTTGTCTACCACAAGCATCTGAAGAGAG
TTTTCCTGATAGATCTCAACAGTACACACGGCACTTTCTTGGGTCACATTCGGTTGGAAC
CTCACAAGCCTCAGCAAATTCCCATCGATTCCACGGTCTCATTTGGCGCATCCACAAGGG
CATACACTCTGCGCGAGAAGCCTCAGACATTGCCATCGGCTGTGAAAGGAGATGAGAAGA
TGGGTGGAGAGGATGATGAACTCAAGGGCTTACTGNGGCTTCCAGAGGAGGAAACTGAGC
TTGATAACCTGACAGAGTTCAACACTGCCCACAACAAAGCGATTTCTACCCTGACCATTG
ANGAGGNNAATCTGGACATTCAAAGACCANAGAGGAAGAGGAAGAACTCACGGGTGACAT
TCAGTGAGGATGATGAGATCATCAACCCAGAGATGTGGATCCCTCAGTGGNTCGATTCAG
GAACATGGNTGCAACTGCAGTGGNTCCAGTCAAGAAAAACGTGTGGNAGGCCCTGGCTCC
CTGGCCTGNAGAATCANGNACANGCGATGCANAACTTGCCTTAGCAGAGACTCTACGGGG
CCTGCCCCACACACATGAGCAGCTCCAGCCCATGCATCATGGACACCTCATCGTGGCTGC
CATGCATACCAANCTGCCTGAGTGACTGACTCCTGTGTCGN
Restriction Sites NotI-NotI     
ACCN NM_002713
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002713.2, NP_002704.1
RefSeq Size 2590 bp
RefSeq ORF 384 bp
Locus ID 5511
Cytogenetics 1p35.3
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene, through alternative splicing, encodes three different isoforms. Two of the protein isoforms encoded by this gene are specific inhibitors of type 1 serine/threonine protein phosphatases and can bind but not cleave RNA. The third protein isoform lacks the phosphatase inhibitory function but is a single-strand endoribonuclease comparable to RNase E of E. coli. This isoform requires magnesium for its function and cleaves specific sites in A+U-rich regions of RNA. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) encodes the shortest isoform (gamma, also called ARD-1). It has its first exon longer at the 3' end and lacks an internal exon as compared to that of transcript variant 1. The gamma isoform uses a different translation start site and is N-terminally truncated as compared to isoform alpha encoded by variant 1. Isoform gamma contains ribonuclease activity.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.