CD75 (ST6GAL1) (NM_173217) Human Untagged Clone

CAT#: SC124841

ST6GAL1 (untagged)-Human ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 (ST6GAL1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST6GAL1
• Synonyms: SIAT1; ST6GalI; ST6N
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173217, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACTCTCAGTTGGTTACCACAGAGAAGCGCTTCCTCAAAGACAGTTTGTACAATGAAGGAATCCTAA
  TTGTATGGGACCCATCTGTATACCACTCAGATATCCCAAAGTGGTACCAGAATCCGGATTATAATTTCTT
  TAACAACTACAAGACTTATCGTAAGCTGCACCCCAATCAGCCCTTTTACATCCTCAAGCCCCAGATGCCT
  TGGGAGCTATGGGACATTCTTCAAGAAATCTCCCCAGAAGAGATTCAGCCAAACCCCCCATCCTCTGGGA
  TGCTTGGTATCATCATCATGATGACGCTGTGTGACCAGGTGGATATTTATGAGTTCCTCCCATCCAAGCG
  CAAGACTGACGTGTGCTACTACTACCAGAAGTTCTTCGATAGTGCCTGCACGATGGGTGCCTACCACCCG
  CTGCTCTATGAGAAGAATTTGGTGAAGCATCTCAACCAGGGCACAGATGAGGACATCTACCTGCTTGGAA
  AAGCCACACTGCCTGGCTTCCGGACCATTCACTGCTAA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_173217 unedited
  GGCCGCGAATTCGGCACGAGAGATTTTCCCTTCAATACCTCTGAATGGGAGGGTTATCTG
  CCCAAGGAGAGCATTAGGACCAAGGCTGGGCCTTGGGGCAGGTGTGCTGTTGTGTCGTCA
  GCGGGATCTCTGAAGTCCTCCCAACTAGGCAGAGAAATCGATGATCATGACGCAGTCCTG
  AGGTTTAATGGGGCACCCACAGCCAACTTCCAACAAGATGTGGGCACAAAAACTACCATT
  CGCCTGATGAACTCTCAGTTGGTTACCACAGAGAAGCGCTTCCTCAAAGACAGTTTGTAC
  AATGAAGGAATCCTAATTGTATGGGACCCATCTGTATACCACTCAGATATCCCAAAGTGG
  TACCAGAATCCGGATTATAATTTCTTTAACAACTACAAGACTTATCGTAAGCTGCACCCC
  AATCAGCCCTTTTACATCCTCAAGCCCCAGATGCCTTGGGAGCTATGGGACATTCTTCAA
  GAAATCTCCCCAGAAGAGATTCAGCCAAACCCCCCATCCTCTGGGATGCTTGGTATCATC
  ATCATGATGACGCTGTGTGACCAGGTGGATATTTATGAGTTCCTCCCATCCAAGCGCAAG
  ACTGACGTGTGCTACTACTACCAGAAGTTCTTCGATAGTGCCTGCACGATGGGTGCCTAC
  CACCCGCTGCTCTATGAGAAGAATTTGGTGAAGCATCTCAACCAGGGCACAGATGAGGAC
  ATCTACCTGCTTGGAAAGC
  
• Restriction Sites: NotI-NotI
• ACCN: NM_173217
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_173217.1, NP_775324.1
• RefSeq Size: 3746 bp
• RefSeq ORF: 528 bp
• Locus ID: 6480
• Cytogenetics: 3q27.3
• Protein Families: Secreted Protein
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• Gene Summary: 'This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]'
  Transcript Variant: This variant (3) lacks the exon containing the translation start site compared to variant 1, resulting in an isoform (b) with a shorter N-terminus compared to isoform a. Isoform b is likely to be a soluble rather than membrane-bound protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.