Metallothionein (MT2A) (NM_005953) Human Untagged Clone

CAT#: SC125000

MT2A (untagged)-Human metallothionein 2A (MT2A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MT2A
• Synonyms: MT-2; MT-II; MT2
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005953, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGT
  GCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGG
  CTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_005953 unedited
  CACGAGGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGG
  ATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCA
  AAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTG
  CCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCT
  GATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTT
  TTATGTACAACCCTGACCGTGACCGTTTGCTATATTCCTTTTTCTATGAAATAATGTGAA
  TGATAATAAAACAGCTTTGACTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_005953
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005953.2, NP_005944.1
• RefSeq Size: 372 bp
• RefSeq ORF: 186 bp
• Locus ID: 4502
• Cytogenetics: 16q13
• Gene Summary: 'This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]'