TCF21 (NM_198392) Human Untagged Clone

CAT#: SC125048

TCF21 (untagged)-Human transcription factor 21 (TCF21), transcript variant 1


  "NM_198392" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TCF21"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TCF21
Synonyms bHLHa23; POD1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_198392, the custom clone sequence may differ by one or more nucleotides


ATGTCCACCGGCTCCCTCAGCGATGTGGAGGACCTTCAAGAGGTGGAGATGTTGGAATGTGACGGGTTGA
AAATGGATTCGAACAAGGAATTTGTGACTTCCAACGAGAGCACCGAGGAGAGCTCCAACTGCGAGAATGG
GTCTCCCCAGAAGGGCCGCGGCGGCCTGGGCAAGAGGAGGAAGGCGCCCACCAAGAAGAGCCCCCTGAGC
GGGGTCAGCCAGGAGGGGAAGCAGGTCCAGCGCAACGCCGCCAACGCGCGAGAGCGGGCCCGCATGCGAG
TGCTGAGCAAGGCCTTCTCCAGACTCAAGACCACCCTGCCCTGGGTGCCCCCCGACACCAAGCTCTCCAA
GCTGGACACGCTCAGGCTGGCGTCCAGCTACATCGCCCACTTGAGGCAGATCCTGGCTAACGACAAATAC
GAGAACGGGTACATTCACCCGGTCAACCTGACGTGGCCCTTTATGGTGGCCGGGAAACCCGAGAGTGACC
TGAAAGAAGTGGTGACCGCGAGCCGCTTATGTGGAACCACCGCGTCCTGA


>OriGene 5' read for NM_198392 unedited
CCCCCCCGCCCCCCCCCCTTTTCTCCCCCCCCCCGGTTCAGNATTTGTNATACGACTCAC
TATAGGCGGCCGCGNAATTCGCACCAGCCACGACTCTGGGAGTGGGGAAACAGAGAGCCG
GTTCCTCTGCTGCAGAAGTCCTCGGGGTTCCTTCTCACAACTCTGCGAAGGGGAAAGGGT
TGTGAGACCCAACCAGACCCCAACTCCAGCTCCCAGCAGGAGGTGGCTGCGCCACACTCG
GGAGGCCTCTTGGTTTCAGGGTCTCTCTGTCTCTCTCTCACCCTCTTCCTCGCTTTCTCT
GTCTCTCTGTCTCTCTCTCTCTCTCTCCCTCGTCCACTCCCCCAAACATGTCCACCGGCT
CCCTCAGCGATGTGGAGGACCTTCAAGAGGTGGAGATGTTGGAATGTGACGGGTTGAAAA
TGGATTCGAACAAGGAATTTGTGACTTCCAACGAGAGCACCGAGGAGAGCTCCAACTGCG
AGAATGGGTCTCCCCAGAAGGGCCGCGGCGGCCTGGGCAAGAGGAGGAAGGCGCCCACCA
AGAAGAGCCCCCTGAGCGGNGTCAGCCAGGAGGGGAAGCAGGTCCAGCGCAACGCCGCCA
ACGCGCGAGAGCGGGCCCGCATGCGAGTGCTGAGCAAGGCCTTCTCCAGACTCAAGACCA
CCCTGCCCTGGGTGCCCCCCGACACCAAGCTCTCCAAGCTGGACACGCTCCAGCTGGCGT
TCAGCTACATCGNCCACTTGAGGCAGATCCTGGCTAACGACAAATACGAGAACCGGTACC
ATTCACCCGGTCACCCTGACGTGGCCCTTTATGGTGGCCCGGGAAACCCCGAGAGTGACC
TGAANGAAAATGTGACCGCCAGCCGCTNATGTGGAACCCACCGCGTCCTGACTTTGNAGG
TGCCAGTCTTGGAAAAGCCCCGCTCCCGGGGGGAGACCGCCCCCGGAAGGCGACCCCTGG
CCTCAGGGCTCTCTTTCTT
Restriction Sites NotI-NotI     
ACCN NM_198392
Insert Size 3000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198392.1, NP_938206.1
RefSeq Size 3231 bp
RefSeq ORF 540 bp
Locus ID 6943
Cytogenetics 6q23.2
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.