CTSA (NM_000308) Human Untagged Clone
CAT#: SC126523
CTSA (untagged)-Human cathepsin A (CTSA), transcript variant 1
"NM_000308" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CTSA |
Synonyms | GLB2; GSL; NGBE; PPCA; PPGB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000308, the custom clone sequence may differ by one or more nucleotides
ATGACTTCCAGTCCCCGGGCGCCTCCTGGAGAGCAAGGACGCGGGGGAGCAGAGATGATCCGAGCCGCGC CGCCGCCGCTGTTCCTGCTGCTGCTGCTGCTGCTGCTGCTAGTGTCCTGGGCGTCCCGAGGCGAGGCAGC CCCCGACCAGGACGAGATCCAGCGCCTCCCCGGGCTGGCCAAGCAGCCGTCTTTCCGCCAGTACTCCGGC TACCTCAAAGGCTCCGGCTCCAAGCACCTCCACTACTGGTTTGTGGAGTCCCAGAAGGATCCCGAGAACA GCCCTGTGGTGCTTTGGCTCAATGGGGGTCCCGGCTGCAGCTCACTAGATGGGCTCCTCACAGAGCATGG CCCCTTCCTGGTCCAGCCAGATGGTGTCACCCTGGAGTACAACCCCTATTCTTGGAATCTGATTGCCAAT GTGTTATACCTGGAGTCCCCAGCTGGGGTGGGCTTCTCCTACTCCGATGACAAGTTTTATGCAACTAATG ACACTGAGGTCGCCCAGAGCAATTTTGAGGCCCTTCAAGATTTCTTCCGCCTCTTTCCGGAGTACAAGAA CAACAAACTTTTCCTGACCGGGGAGAGCTATGCTGGCATCTACATCCCCACCCTGGCCGTGCTGGTCATG CAGGATCCCAGCATGAACCTTCAGGGGCTGGCTGTGGGCAATGGACTCTCCTCCTATGAGCAGAATGACA ACTCCCTGGTCTACTTTGCCTACTACCATGGCCTTCTGGGGAACAGGCTTTGGTCTTCTCTCCAGACCCA CTGCTGCTCTCAAAACAAGTGTAACTTCTATGACAACAAAGACCTGGAATGCGTGACCAATCTTCAGGAA GTGGCCCGCATCGTGGGCAACTCTGGCCTCAACATCTACAATCTCTATGCCCCGTGTGCTGGAGGGGTGC CCAGCCATTTTAGGTATGAGAAGGACACTGTTGTGGTCCAGGATTTGGGCAACATCTTCACTCGCCTGCC ACTCAAGCGGATGTGGCATCAGGCACTGCTGCGCTCAGGGGATAAAGTGCGCATGGACCCCCCCTGCACC AACACAACAGCTGCTTCCACCTACCTCAACAACCCGTACGTGCGGAAGGCCCTCAACATCCCGGAGCAGC TGCCACAATGGGACATGTGCAACTTTCTGGTAAACTTACAGTACCGCCGTCTCTACCGAAGCATGAACTC CCAGTATCTGAAGCTGCTTAGCTCACAGAAATACCAGATCCTATTATATAATGGAGATGTAGACATGGCC TGCAATTTCATGGGGGATGAGTGGTTTGTGGATTCCCTCAACCAGAAGATGGAGGTGCAGCGCCGGCCCT GGTTAGTGAAGTACGGGGACAGCGGGGAGCAGATTGCCGGCTTCGTGAAGGAGTTCTCCCACATCGCCTT TCTCACGATCAAGGGCGCCGGCCACATGGTTCCCACCGACAAGCCCCTCGCTGCCTTCACCATGTTCTCC CGCTTCCTGAACAAGCAGCCATACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_000308 |
Insert Size | 1950 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000308.3, NP_000299.2 |
RefSeq Size | 3062 bp |
RefSeq ORF | 1497 bp |
Locus ID | 5476 |
Cytogenetics | 20q13.12 |
Domains | serine_carbpept |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Renin-angiotensin system |
Gene Summary | 'This gene encodes a member of the peptidase S10 family of serine carboxypeptidases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate two chains that comprise the heterodimeric active enzyme. This enzyme possesses deamidase, esterase and carboxypeptidase activities and acts as a scaffold in the lysosomal multienzyme complex. Mutations in this gene are associated with galactosialidosis. [provided by RefSeq, Nov 2015]' Transcript Variant: This variant (1) encodes the longest isoform (a). This isoform (a) may undergo proteolytic processing similar to isoform (b). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC317835 | CTSA (untagged)-Human cathepsin A (CTSA), transcript variant 1 |
USD 840.00 |
|
RC213409 | CTSA (Myc-DDK-tagged)-Human cathepsin A (CTSA), transcript variant 1 |
USD 460.00 |
|
RG213409 | CTSA (GFP-tagged) - Human cathepsin A (CTSA), transcript variant 1 |
USD 510.00 |
|
RC213409L1 | Lenti ORF clone of Human cathepsin A (CTSA), transcript variant 1, Myc-DDK-tagged |
USD 816.00 |
|
RC213409L2 | Lenti ORF clone of Human cathepsin A (CTSA), transcript variant 1, mGFP tagged |
USD 660.00 |
|
RC213409L3 | Lenti ORF clone of Human cathepsin A (CTSA), transcript variant 1, Myc-DDK-tagged |
USD 660.00 |
|
RC213409L4 | Lenti ORF clone of Human cathepsin A (CTSA), transcript variant 1, mGFP tagged |
USD 660.00 |
{0} Product Review(s)
Be the first one to submit a review