CAMK2D (NM_172128) Human Untagged Clone
CAT#: SC126554
CAMK2D (untagged)-Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2
"NM_172128" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CAMK2D |
| Synonyms | CAMKD |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_172128, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCGACCACAACCTGCACCAGGTTCACGGACGAGTATCAGCTTTTCGAGGAGCTTGGAAAGGGGG CATTCTCAGTGGTGAGAAGATGTATGAAAATTCCTACTGGACAAGAATATGCTGCCAAAATTATCAACAC CAAAAAGCTTTCTGCTAGGGATCATCAGAAACTAGAAAGAGAAGCTAGAATCTGCCGTCTTTTGAAGCAC CCTAATATTGTGCGACTTCATGATAGCATATCAGAAGAGGGCTTTCACTACTTGGTGTTTGATTTAGTTA CTGGAGGTGAACTGTTTGAAGACATAGTGGCAAGAGAATACTACAGTGAAGCTGATGCCAGTCATTGTAT ACAGCAGATTCTAGAAAGTGTTAATCATTGTCACCTAAATGGCATAGTTCACAGGGACCTGAAGCCTGAG AATTTGCTTTTAGCTAGCAAATCCAAGGGAGCAGCTGTGAAATTGGCAGACTTTGGCTTAGCCATAGAAG TTCAAGGGGACCAGCAGGCGTGGTTTGGTTTTGCTGGCACACCTGGATATCTTTCTCCAGAAGTTTTACG TAAAGATCCTTATGGAAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTATATTCTACTTGTGGGG TATCCACCCTTCTGGGATGAAGACCAACACAGACTCTATCAGCAGATCAAGGCTGGAGCTTATGATTTTC CATCACCAGAATGGGACACGGTGACTCCTGAAGCCAAAGACCTCATCAATAAAATGCTTACTATCAACCC TGCCAAACGCATCACAGCCTCAGAGGCACTGAAGCACCCATGGATCTGTCAACGTTCTACTGTTGCTTCC ATGATGCACAGACAGGAGACTGTAGACTGCTTGAAGAAATTTAATGCTAGAAGAAAACTAAAGGGTGCCA TCTTGACAACTATGCTGGCTACAAGGAATTTCTCAGCAGCCAAGAGTTTGTTGAAGAAACCAGATGGAGT AAAGGAGTCAACTGAGAGTTCAAATACAACAATTGAGGATGAAGATGTGAAAGCACGAAAGCAAGAGATT ATCAAAGTCACTGAACAACTGATCGAAGCTATCAACAATGGGGACTTTGAAGCCTACACAAAAATCTGTG ACCCAGGCCTTACTGCTTTTGAACCTGAAGCTTTGGGTAATTTAGTGGAAGGGATGGATTTTCACCGATT CTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAATCCACACTATTATTCTAAACCCTCATGTACAT CTGGTAGGGGATGATGCCGCCTGCATAGCATATATTAGGCTCACACAGTACATGGATGGCAGTGGAATGC CAAAGACAATGCAGTCAGAAGAGACTCGTGTGTGGCACCGCCGGGATGGAAAGTGGCAGAATGTTCATTT TCATCGCTCGGGGTCACCAACAGTACCCATCAACTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_172128 |
| Insert Size | 3460 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_172128.2, NP_742126.1 |
| RefSeq Size | 5776 bp |
| RefSeq ORF | 1437 bp |
| Locus ID | 817 |
| Cytogenetics | 4q26 |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Calcium signaling pathway, ErbB signaling pathway, Glioma, GnRH signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Wnt signaling pathway |
| Gene Summary | 'The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]' Transcript Variant: This variant (2) lacks an exon in the 3' coding region, compared to variant 3. The resulting isoform (2) has a shorter C-terminus, compared to isoform 3. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extend of this RefSeq trasncript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222121 | CAMK2D (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2 |
USD 686.00 |
|
| RG222121 | CAMK2D (GFP-tagged) - Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2 |
USD 460.00 |
|
| RC222121L1 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
| RC222121L2 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2, mGFP tagged |
USD 620.00 |
|
| RC222121L3 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC222121L4 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China