Protein kinase Y linked (PRKY) (NM_002760) Human Untagged Clone

CAT#: SC126856

PRKY (untagged)-Human protein kinase, Y-linked (PRKY)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRKY
• Synonyms: OTTHUMP00000033227; protein kinase, Y-linked
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002760 edited
  GGACCTGAGTGCCTCCCCATGGAGGCGCCCGGGCCGGCCCAGGCGGCCGCGGCGGAGAGC
  AACTCCCGAGAGGTGACGGAGGATGCCGCCGACTGGGCGCCCGCGCTCTGCCCCAGCCCC
  GAGGCGCGGTCGCCGGAGGCGCCTGCCTACCGCCTGCAGGACTGCGACGCGCTGGTCACC
  ATGGGCACTGGGACGTTCGGGCGGGTGCACCTGGTGAAGGAGAAGACAGCCAAGCATTTC
  TTCGCCCTCAAGGTGATGAGCATTCCCGACGTCATCCGCCGGAAGCAGGAGCAGCACGTG
  CACAATGAGAAGTCTGTCCTGAAGGAAGTCAGCCACCCGTTCCTCATCAGGCTGTTCTGG
  ACGTGGCATGAGGAGCGCTTCCTCTACATGCTCATGGAGTATGTGCCGGGTGGCGAGCTC
  TTCAGCTACCTGCGCAACCGGGGGCACTTCTCCAGCACCACGGGGCTCTTCTACTCTGCG
  GAGATCATCTGTGCCATTGAGTACCTGCACTCCAAGGAGATCGTCTACAGGGATTTGAAG
  CCGGAGAACATCCTGCTGGATAGGGATGGTCACATCAAGCTCACGGACTTTGGGTTTGCC
  AAGAAGCTGGTAGACAGGACTTGGACCCTCTGTGGAACACCCGAGTACCTAGCCCCCGAA
  GTCATTCAGAGCAAGGGCCACGGAAGGGCCGTGGACTGGTGGGCCCTCGGCATCCTGATA
  TTCGAGATGCTTTCGGGGTTTCCTCCATTTTTTGATGACAACCCGTTTGGCATTTATCAG
  AAAATTCTTGCAGGCAAACTATATTTCCCCAGACATTTGGATTTCCATGTAAAAACGGGG
  CGAATGATGTGAAACACCATCGGTGGTTCCGCTCCGTGGACTGGAAAGCTGTTCC
  
• Restriction Sites: Please inquire
• ACCN: NM_002760
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002760.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002760.2, NP_002751.1
• RefSeq Size: 7228 bp
• RefSeq ORF: 834 bp
• Locus ID: 5616
• Cytogenetics: Yp11.2
• Domains: pkinase, TyrKc, S_TKc
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: 'This gene is similar to the protein kinase, X-linked gene in the pseudoautosomal region of the X chromosome. The gene is classified as a transcribed pseudogene because it has lost a coding exon that results in all transcripts being candidates for nonsense-mediated decay (NMD) and unlikely to express a protein. Abnormal recombination between this gene and a related gene on chromosome X is a frequent cause of XX males and XY females. [provided by RefSeq, Jul 2010]'