Claudin18 (CLDN18) (NM_016369) Human Untagged Clone
CAT#: SC126873
CLDN18 (untagged)-Human claudin 18 (CLDN18), transcript variant 1
"NM_016369" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CLDN18 |
| Synonyms | SFTA5; SFTPJ |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_016369, the custom clone sequence may differ by one or more nucleotides
ATGTCCACCACCACATGCCAAGTGGTGGCGTTCCTCCTGTCCATCCTGGGGCTGGCCGGCTGCATCGCGG CCACCGGGATGGACATGTGGAGCACCCAGGACCTGTACGACAACCCCGTCACCTCCGTGTTCCAGTACGA AGGGCTCTGGAGGAGCTGCGTGAGGCAGAGTTCAGGCTTCACCGAATGCAGGCCCTATTTCACCATCCTG GGACTTCCAGCCATGCTGCAGGCAGTGCGAGCCCTGATGATCGTAGGCATCGTCCTGGGTGCCATTGGCC TCCTGGTATCCATCTTTGCCCTGAAATGCATCCGCATTGGCAGCATGGAGGACTCTGCCAAAGCCAACAT GACACTGACCTCCGGGATCATGTTCATTGTCTCAGGTCTTTGTGCAATTGCTGGAGTGTCTGTGTTTGCC AACATGCTGGTGACTAACTTCTGGATGTCCACAGCTAACATGTACACCGGCATGGGTGGGATGGTGCAGA CTGTTCAGACCAGGTACACATTTGGTGCGGCTCTGTTCGTGGGCTGGGTCGCTGGAGGCCTCACACTAAT TGGGGGTGTGATGATGTGCATCGCCTGCCGGGGCCTGGCACCAGAAGAAACCAACTACAAAGCCGTTTCT TATCATGCCTCAGGCCACAGTGTTGCCTACAAGCCTGGAGGCTTCAAGGCCAGCACTGGCTTTGGGTCCA ACACCAAAAACAAGAAGATATACGATGGAGGTGCCCGCACAGAGGACGAGGTACAATCTTATCCTTCCAA GCACGACTATGTGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_016369 |
| ORF Size | 786 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Reference Data | |
| RefSeq | NM_016369.3, NP_057453.1 |
| RefSeq Size | 3359 |
| RefSeq ORF | 786 |
| Locus ID | 51208 |
| Domains | PMP22_Claudin |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (1) encodes isoform 1, also known as isoform A1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212135 | CLDN18 (Myc-DDK-tagged)-Human claudin 18 (CLDN18), transcript variant 1 |
USD 98.00 |
|
| RG212135 | CLDN18 (GFP-tagged) - Human claudin 18 (CLDN18), transcript variant 1 |
USD 460.00 |
|
| RC212135L1 | Lenti-ORF clone of CLDN18 (Myc-DDK-tagged)-Human claudin 18 (CLDN18), transcript variant 1 |
USD 620.00 |
|
| RC212135L2 | Lenti-ORF clone of CLDN18 (mGFP-tagged)-Human claudin 18 (CLDN18), transcript variant 1 |
USD 620.00 |
|
| RC212135L3 | Lenti-ORF clone of CLDN18 (Myc-DDK-tagged)-Human claudin 18 (CLDN18), transcript variant 1 |
USD 620.00 |
|
| RC212135L4 | Lenti-ORF clone of CLDN18 (mGFP-tagged)-Human claudin 18 (CLDN18), transcript variant 1 |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China