Ribosomal Protein S29 (RPS29) (NM_001032) Human Untagged Clone

CAT#: SC126912

RPS29 (untagged)-Human ribosomal protein S29 (RPS29), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPS29
• Synonyms: DBA13; S29; uS14
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001032, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTCGTGTCT
  GTTCAAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGC
  GAAGGATATCGGTTTCATTAAGTTGGACTAA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_001032 unedited
  NCGGGCCGCGGAATTCCCGGGGAATCGTCGACCCACAGCGTCCGCGGGAGCGTGGGTCGC
  CCACGCGTCGGGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGG
  CCAGGGTTCTCGCTCTTGTCGTGTCTGTTCAAACCGGCACGGTCTGATCCGGAAATATGG
  CCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGCGAAGGATATCGGTTTCATTAAGTT
  GGACTAAATGCTCTTCCTTCAGAGGATTATCCGGGGCATCTACTCAATGAAAAACCATGA
  TAATTCTTTGTATATAAAATAAACATTTGAAAAAACCCTTCTGAAAAGAAAAAAAAGCGA
  AAATAGAAGGTGAAGGGGGAGGGGAGACGGGAGGGGGCATATATAACACAAAGCGCGATT
  GACACCCAAAAAAGAGGGCGGCCGCGCGCATAGCTGTTTCCTGAACAGATCCCGGGGGGG
  ATCCCCGGGGACCCCCCCCAAGGGCCCTTCCGGGCCCTGGGAAGTGCCACTTCCAGGCCC
  GACAGCCTGGGGCAAATAAAACAAAGTGCACCCTTTTTGGCGGATAAGGGGACCTTCTAA
  ATATAAGGGGGGGGGGGGGGGGCGTTTCGTATTGGCAACCGCGATGAAGACAGACGGGGT
  GGCCGCGGGGGCTACTAGCAAGAACAGGGGGTGTTGGGGTGTTTTGTTAGGCCCCACCGA
  GCATTTCCCTCCCCCTTGTTTTTGACAGTACCCCCGGCGGCGGCGTTGTAGAGTAAAGGG
  GATTCACGCAGGGCCACACCGGGTACAACGAATTTACCCGTTTGTCGGGAGATAATAAGA
  GTACTGAGAGAGTAGGGGCGTGGGGGGGGAATGGCTTAAAGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001032
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001032.3, NP_001023.1
• RefSeq Size: 302 bp
• RefSeq ORF: 171 bp
• Locus ID: 6235
• Cytogenetics: 14q21.3
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]'
  Transcript Variant: This variant (1) is the predominant transcript and encodes isoform 1.