SFRS5 (SRSF5) (NM_006925) Human Untagged Clone
CAT#: SC127158
SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2
"NM_006925" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | SRSF5 |
| Synonyms | HRS; SFRS5; SRP40 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_006925, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGCTGTCGGGTATTCATCGGGAGACTAAATCCAGCGGCCAGGGAGAAGGACGTGGAAAGATTCT TCAAGGGATATGGACGGATAAGAGATATTGATCTGAAAAGAGGCTTTGGTTTTGTGGAATTTGAGGATCC AAGGGATGCAGATGATGCTGTGTATGAGCTTGATGGAAAAGAACTCTGTAGTGAAAGGGTTACTATTGAA CATGCTAGGGCTCGGTCACGAGGTGGAAGAGGTAGAGGACGATACTCTGACCGTTTTAGTAGTCGCAGAC CTCGAAATGATAGACGAAATGCTCCACCTGTAAGAACAGAAAATCGTCTTATAGTTGAGAATTTATCCTC AAGAGTCAGCTGGCAGGATCTCAAAGATTTCATGAGACAAGCTGGGGAAGTAACGTTTGCGGATGCACAC CGACCTAAATTAAATGAAGGGGTGGTTGAGTTTGCCTCTTATGGTGACTTAAAGAATGCTATTGAAAAAC TTTCTGGAAAGGAAATAAATGGGAGAAAAATAAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCAAG AAGCAGGTCTCGATCCCGGACCAGAAGTTCCTCTAGGTCTCGTAGCCGATCCCGTTCCCGTAGTCGCAAA TCTTACAGCCGGTCAAGAAGCAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTC CCGTGCCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCA GAGGTCCCGGTCCCGATCAAGGTCCAGATCAGTTGACAGTGGCAATTAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_006925 |
| Insert Size | 1600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | A TrueClone. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006925.2, NP_008856.1 |
| RefSeq Size | 1517 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 6430 |
| Cytogenetics | 14q24.1 |
| Protein Pathways | Spliceosome |
| Gene Summary | 'The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC317393 | SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
USD 660.00 |
|
| RC218652 | SRSF5 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
USD 300.00 |
|
| RG218652 | SRSF5 (GFP-tagged) - Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
USD 460.00 |
|
| RC218652L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
| RC218652L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
USD 620.00 |
|
| RC218652L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC218652L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China