UBE2D2 (NM_181838) Human Untagged Clone

CAT#: SC127401

UBE2D2 (untagged)-Human ubiquitin-conjugating enzyme E2D 2 (UBE2D2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2D2
• Synonyms: E2(17)KB2; PUBC1; UBC4; UBC4/5; UBCH4; UBCH5B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_181838 edited
  AAGAGAATCCACAAGGAATTGAATGATCTGGCACGGGACCCTCCAGCACAGTGTTCAGCA
  GGTCCTGTTGGAGATGATATGTTCCATTGGCAAGCTACAATAATGGGGCCAAATGACAGT
  CCCTATCAGGGTGGAGTATTTTTCTTGACAATTCATTTCCCAACAGATTACCCCTTCAAA
  CCACCTAAGGTTGCATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGC
  ATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGTACTC
  TTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGAGATT
  GCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGACTCAG
  AAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGGGGAA
  CTCTGAAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGCCTCA
  TCTT
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_181838 unedited
  AAACCACCTAAGGTTGCATTTACAACAAGAATTTATTCATCCAAATATTAACAGTAATGG
  CAGCATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGT
  ACTCTTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGA
  GATTGCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGAC
  TCAGAAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGN
  GGAACTCTGNAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGC
  CTCATCTTCCCCTGTGCACATGTTTTACCT
  
• Restriction Sites: NotI-NotI
• ACCN: NM_181838
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181838.1, NP_862821.1
• RefSeq Size: 2879 bp
• RefSeq ORF: 357 bp
• Locus ID: 7322
• Cytogenetics: 5q31.2
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: 'Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]'
  Transcript Variant: This variant (2) contains an alternate exon in the 5' region, differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2 which is shorter at the N-terminus compared to isoform 1.