OAZ2 (NM_002537) Human Untagged Clone

CAT#: SC127406

OAZ2 (untagged)-Human ornithine decarboxylase antizyme 2 (OAZ2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OAZ2
• Synonyms: AZ2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002537 edited
  ATGATAAACACCCAGGACAGTAGTATTTTGCCTTTGAGTAACTGTCCCCAGCTCCAGTGC
  TGCAGGCACATTGTTCCAGGGCCTCTGTGGTGCTCCGATGCCCCTCACCCACTGTCGAAG
  ATCCCCGGTGGGCGAGGGGGCGGCAGGGATCCTTCTCTCTCAGCTCTAATATATAAGGAC
  GAGAAGCTCACTGTGACCCAGGACCTCCCTGTGAATGATGGAAAACCTCACATCGTCCAC
  TTCCAGTATGAGGTCACCGAGGTGAAGGTCTCTTCTTGGGATGCAGTCCTGTCCAGCCAG
  AGCCTGTTTGTAGAAATCCCAGATGGATTATTAGCTGATGGGAGCAAAGAAGGATTGTTA
  GCACTGCTAGAGTTTGCTGAAGAGAAGATGAAAGTGAACTATGTCTTCATCTGCTTCAGG
  AAGGGCCGAGAAGACAGAGCTCCACTCCTGAAGACCTTCAGCTTCTTGGGCTTTGAGATT
  GTACGTCCAGGCCATCCCTGTGTCCCCTCTCGGCCAGATGTGATGTTCATGGTTTATCCC
  CTGGACCAGAACTTGTCCGATGAGGACTAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_002537
• ORF Size: 192 bp
• Insert Size: 1950
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_002537.1, NP_002528.1
• RefSeq Size: 1906
• RefSeq ORF: 192
• Locus ID: 4947
• Gene Summary: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamines. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 2, the second member of the antizyme family. Like antizyme 1, antizyme 2 has broad tissue distribution, inhibits ODC activity and polyamine uptake, and stimulates ODC degradation in vivo; however, it fails to promote ODC degradation in vitro. Antizyme 2 is expressed at lower levels than antizyme 1, but is evolutionary more conserved, suggesting it likely has an important biological role. Studies also show different subcellular localization of antizymes 1 and 2, indicating specific function for each antizyme in discrete compartments of the cell. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (1) encodes the longer isoform (1).