RPS28 (NM_001031) Human Untagged Clone

CAT#: SC127600

RPS28 (untagged)-Human ribosomal protein S28 (RPS28)


  "NM_001031" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RPS28"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPS28
Synonyms DBA15; eS28; S28
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC127600 sequence for NM_001031 edited (data generated by NextGen Sequencing)
ATGGACACCAGCCGTGTGCAGCCTATCAAGCTGGCCAGGGTCACCAAGGTCCTGGGCAGG
ACCGGTTCTCAGGGACAGTGCACGCAGGTGCGCGTGGAATTCATGGACGACACGAGCCGA
TCCATCATCCGCAATGTAAAAGGCCCCGTGCGCGAGGGCGACGTGCTCACCCTTTTGGAG
TCAGAGCGAGAAGCCCGGAGGTTGCGCTGA

Clone variation with respect to NM_001031.4
>OriGene 5' read for NM_001031 unedited
CGGCCGCGAATTCGGCACCAGGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
TCAAGCTGGCCAGGGTCACCAAGGTCCTGGGCAGGACCGGTTCTCAGGGACAGTGCACGC
AGGTGCGCGTGGAATTCATGGACGACACGAGCCGATCCATCATCCGCAATGTAAAAGGCC
CCGTGCGCGAGGGCGACGTGCTCACCCTTTTGGAGTCAGAGCGAGAAGCCCGGAGGTTGC
GCTGAGCTTGGCTGCTCGCTGGGTCTTGGATGTCGGGTTCGACCACTTGGCCGATGGGAA
TGGTCTGTCACAATCTGCTCCTTTTTTTTGTCCGCCACACGTAACTGAGATGCTCCTTTA
ATAAAGCGTTTGTGTTTCANGTTNANAAAAANNAANNAAAAAAAAAAAAAAAANCCTCGA
CTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGT
GACCCCTCCCCAGTGCCTCTCCCTGCCCTGGGAAGTTGCCACTCCAGTGCCCCACCACCC
TTTGTCCTAATAAAATTAAGTTGCATCATTTTTGTCTGACCTAGGGGTCCCTTTATAATA
ATATGGGGTGAGGGGGGGGGGTGTTTTTGAGAAAAAGGGGGCCAAATTTTGGAAAAAACA
CCTTGTAAGGGCCTGGCGGGGGTCATTTGGGAACCAAGCTTGGGAGCGCAGGGGCACAAT
CTGGGCTTACTGC
Restriction Sites NotI-NotI     
ACCN NM_001031
Insert Size 310 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001031.3, NP_001022.1
RefSeq Size 1269 bp
RefSeq ORF 210 bp
Locus ID 6234
Cytogenetics 19p13.2
Domains Ribosomal_S28e
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S28E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.