RAP1A (NM_002884) Human Untagged Clone

CAT#: SC127673

RAP1A (untagged)-Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2


  "NM_002884" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RAP1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAP1A
Synonyms C21KG; G-22K; KREV-1; KREV1; RAP1; SMGP21
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_002884, the custom clone sequence may differ by one or more nucleotides


ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACAGTTCAGTTTG
TTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTACAGAAAGCAAGTTGAAGTCGA
TTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGGACAGAGCAATTTACAGCAATGAGGGATTTG
TATATGAAGAACGGCCAAGGTTTTGCACTAGTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTAC
AGGACCTGAGGGAACAGATTTTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAA
ATGTGACCTGGAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAAC
TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGACCTGGTCAGAC
AGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAG


>OriGene 5' read for NM_002884 unedited
NGGTTCACATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACCAGGGGATCGTC
AGTATTTAAACAGATCACATCATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGC
GTTGGGAAGTCTGCTCTGACAGTTCAGTTTGTTCAGGGAATTTTTGTTGAAAAATATGAC
CCAACGATAGAAGATTCCTACAGAAAGCAAGTTGAAGTCGATTGCCAACAGTGTATGCTC
GAAATCCTGGATACTGCAGGGACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAG
AACGGCCAAGGTTTTGCACTAGTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTA
CAGGACCTGAGGGAACAGATTTTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTG
GTTGGCAATAAATGTGACCTGGAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAAT
TTAGCAAGACAGTGGTGTAACTGTGCCTTTTTTAGAATCTTCTGCAAAGTCAAAGATCAA
TGTTAATGAGATATTTTATGACCTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAA
GAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAGGCCCATAGTCAGCAGCAGCTCTG
AGCCAGATTACAGGAATGAAGAACTGTTGCCTAATTGGAAAGTGCCAGCATTCCAGACTT
CAAAAATAAAATCTGAGAGGCTTCTNCTGTTTATATATATGTGAAGATTTAGATCTTATA
TGGTNNNGCACAGTCCTGGAGAAAAAAATGCTCTGTGTTNTCTCTTGGAAAATAGACATA
GTTTTTCTCTTTGCATAGCAGTATTACAGATGTGAAATATACTGACTCTATATGATATAC
AAAGAGCATGGTGCATTTCAATGTTAGATATGCTCTATATCAATGC
Restriction Sites NotI-NotI     
ACCN NM_002884
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002884.2, NP_002875.1
RefSeq Size 1812 bp
RefSeq ORF 555 bp
Locus ID 5906
Cytogenetics 1p13.2
Domains ras, RAN, RAS, RHO, RAB
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Renal cell carcinoma
Gene Summary 'This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]'
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 4. Variants 1-5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.