MAP4 (NM_030885) Human Untagged Clone

CAT#: SC127765

MAP4 (untagged)-Human microtubule-associated protein 4 (MAP4), transcript variant 3


  "NM_030885" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MAP4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP4
Synonyms DKFZp779A1753; MGC8617
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_030885, the custom clone sequence may differ by one or more nucleotides


ATGGCTGACCTCAGTCTTGCAGATGCATTAACAGAACCATCTCCAGACATTGAGGGAGAGATAAAGCGGG
ACTTCATTGCCACACTAGAGGCAGAGGCCTTTGATGATGTTGTGGGAGAAACTGTTGGAAAAACAGACTA
TATTCCTCTCCTGGATGTTGATGAGAAAACCGGGAACTCAGAGTCAAAGAAGAAACCGTGCTCAGAAACT
AGCCAGATTGAAGATACTCCATCTTCTAAACCAACACTCCTAGCCAATGGTGGTCATGGAGTAGAAGGGA
GCGATACTACAGAAGCCTAG


>OriGene 5' read for NM_030885 unedited
AATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGTCTCGGCGGCGGCGGG
CAGTTGCAGTGGTGCAGAATGGCTGACCTCAGTCTTGCAGATGCATTAACAGAACCATCT
CCAGACATTGAGGGAGAGATAAAGCGGGACTTCATTGCCACACTAGAGGCAGAGGCCTTT
GATGATGTTGTGGGAGAAACTGTTGGAAAAACAGACTATATTCCTCTCCTGGATGTTGAT
GAGAAAACCGGGAACTCAGAGTCAAAGAAGAAACCGTGCTCAGAAACTAGCCAGATTGAA
GATACTCCATCTTCTAAACCAACACTCCTAGCCAATGGTGGTCATGGAGTAGAAGGGAGC
GATACTACAGAAGCCTAGCGTGTCTCTCAACACTGGGGCTGCTGCAACACCAGACCAGTG
ATCTTTCCTAAGCATCGTTATACTTCTAAAACCTTCAGCATTTTGCAGAGCTTTGCTTTT
CATTCCTGGACATGATGTAGAAGAAACTGAGGGTAGTTCTTCGGGGCCTATTTCTGCTGA
TGCCTGAGCAAACAACCTGCTTCCTCTTGTGCTCTGCAGGGTTTGATGGAGCCTCATTTC
CCTTTGTGAACACAAAGTGCAAAATGAATTCTTTTTAATTTTAGTAATTTTTACAAAGGT
TATCTAATGTCTTTTATTTCTTGTTTTCTTTATGATTNTATCATTTGATTCATTCTCACA
TTNTTTTCTTTTAATATTTNTAGTTGACCTTTTTCCTTTGGGTTTCAATGTTCACATGAA
TCAGATAGTGTACACCAATGAGACATGTGTTTCATAAGGGGTTGAGCCACCATACTGCGC
GAATTCCTTTCTCTCCCTCTCTTCTTTCTGAGCTGCTTTAGGGAGGTATCTACAGCTACT
AGTTCTCTCACTACAAACTATATGAA
Restriction Sites NotI-NotI     
ACCN NM_030885
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030885.2, NP_112147.2
RefSeq Size 3155 bp
RefSeq ORF 300 bp
Locus ID 4134
Cytogenetics 3p21.31
Domains tubulin-binding
Gene Summary 'The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
Transcript Variant: This variant (3) lacks multiple exons in the 3' region and uses an unique splice site at the 3' end-exon compared to variant 1. The resulting isoform (3) has a distinct and shorter C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.