p16INK4A (CDKN2A) (NM_000077) Human Untagged Clone

CAT#: SC300006

CDKN2A (untagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDKN2A
• Synonyms: ARF; CDK4I; CDKN2; CMM2; INK4; INK4A; MLM; MTS-1; MTS1; P14; P14ARF; P16; P16-INK4A; P16INK4; P16INK4A; P19; P19ARF; TP16
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000077 edited
  AGGGGCTGGCTGGTCACCAGAGGGTGGGGCGGACCGCGTGCGCTCGGCGGCTGCGGAGAG
  GGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCCGGCGGCGGGGAGCAGCATG
  GAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGG
  GCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATC
  CAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAG
  CCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGC
  TTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCC
  TGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTAC
  CTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAA
  GGTCCCTCAGACATCCCCGATTGAAAGAACCAGAGAGGCTCTGAGACTCGACT
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_000077 unedited
  GTGGGGCGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGC
  GGGGAGCAGCATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGC
  CACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCT
  GCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATCCAGGTCATGATGATGGGCAGCGC
  CCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCAC
  TCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCT
  GCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCT
  GGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCAC
  CAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGACATCCCCGATTG
  AAAGAACCAGAGAGGCTCTGAGACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTC
  CTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGA
  AGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATAAGTTGCATCATTTTGTCT
  GACTAGGTGTCCTTCT
  
• Restriction Sites: Please inquire
• ACCN: NM_000077
• Insert Size: 600 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000077.3, NP_000068.1
• RefSeq Size: 1163 bp
• RefSeq ORF: 471 bp
• Locus ID: 1029
• Cytogenetics: 9p21.3
• Protein Families: Druggable Genome
• Protein Pathways: Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer
• Gene Summary: 'This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]'
  Transcript Variant: This variant (1) is also known as alpha. Transcripts 1 and 4, encoding p16INK4a and p14ARF, have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p16INK4a protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 4 (p14ARF).